RNA id: TCONS_00008047



Basic Information


Item Value
RNA id TCONS_00008047
length 289
RNA type mRNA
GC content 0.49
exon number 4
gene id XLOC_004201
representative False

Chromosome Information


Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 30106182 ~ 30158609 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


GTAACATGGCGGCCTGTATATCCAATGGAAAGTAAAACAGCAGCACAGCAGGACTGTCCGAGCTGACGCGGTGGCTTATTAGGTGCTCTCCAGTTTATGTCCACTTCATGTGTTTTTCCAGGTCATCATGGGAAAAACCCACCAGAAAGACAAGAAGCACCATAAGGAGAAATCGGGGAGGAATAATGAAGATTCACAGCCTTCACAAAAGCTCACAGAGGCGTTCAGCTGGGAAATGTACTTGCGGGAGACGTCGTCCTGTCCTGCTTCCCCCAGCTGTTTTAGACAG

Function


GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0045892 negative regulation of transcription, DNA-templated biological_process
GO:0005634 nucleus cellular_component
GO:0042393 histone binding molecular_function
GO:0003682 chromatin binding molecular_function

KEGG:

id description
ko03036 Chromosome and associated proteins

ZFIN:

id description
ZDB-GENE-130530-546 Predicted to enable chromatin binding activity and histone binding activity. Predicted to be involved in negative regulation of transcription, DNA-templated. Predicted to act upstream of or within regulation of transcription, DNA-templated. Predicted to be active in nucleus. Orthologous to human SCML2 (Scm polycomb group protein like 2).

Ensembl:

ensembl_id ENSDART00000155278

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00008040 lncRNA downstream 189337 29961114 ~ 29961901 (-) True XLOC_004198
TCONS_00008036 lncRNA downstream 230236 29918315 ~ 29921002 (-) False XLOC_004197
TCONS_00008027 lncRNA downstream 389227 29760108 ~ 29762011 (-) True XLOC_004194
TCONS_00008025 lncRNA downstream 413991 29734578 ~ 29737247 (-) True XLOC_004193
TCONS_00008023 lncRNA downstream 493368 29652690 ~ 29657870 (-) True XLOC_004191
TCONS_00008053 lncRNA upstream 203437 30361628 ~ 30364805 (-) True XLOC_004204
TCONS_00008812 lncRNA upstream 1042028 31200219 ~ 31202839 (-) True XLOC_004211
TCONS_00008813 lncRNA upstream 1046734 31204925 ~ 31211308 (-) True XLOC_004212
TCONS_00008814 lncRNA upstream 1992027 32150218 ~ 32157526 (-) False XLOC_004216
TCONS_00008815 lncRNA upstream 1996763 32154954 ~ 32156318 (-) True XLOC_004216
TCONS_00008044 mRNA downstream 12939 30106182 ~ 30138299 (-) False XLOC_004201
TCONS_00008041 mRNA downstream 154881 29981678 ~ 29996357 (-) False XLOC_004199
TCONS_00008042 mRNA downstream 154894 29981680 ~ 29996344 (-) True XLOC_004199
TCONS_00008038 mRNA downstream 204311 29936748 ~ 29946927 (-) False XLOC_004197
TCONS_00008037 mRNA downstream 204598 29936743 ~ 29946640 (-) False XLOC_004197
TCONS_00008049 mRNA upstream 174768 30332959 ~ 30341431 (-) True XLOC_004202
TCONS_00008050 mRNA upstream 190082 30348273 ~ 30352333 (-) True XLOC_004203
TCONS_00008051 mRNA upstream 197251 30355442 ~ 30364847 (-) False XLOC_004204
TCONS_00008054 mRNA upstream 207477 30365668 ~ 30508843 (-) False XLOC_004205
TCONS_00008055 mRNA upstream 209447 30367638 ~ 30508851 (-) False XLOC_004205
TCONS_00008043 other downstream 49981 30101142 ~ 30101257 (-) True XLOC_004200
TCONS_00008039 other downstream 204598 29944930 ~ 29946640 (-) True XLOC_004197
TCONS_00008033 other downstream 241613 29896372 ~ 29909625 (-) False XLOC_004196
TCONS_00008030 other downstream 335036 29809697 ~ 29816202 (-) False XLOC_004195
TCONS_00008022 other downstream 493386 29652690 ~ 29657852 (-) False XLOC_004191
TCONS_00008052 other upstream 199918 30358109 ~ 30364824 (-) False XLOC_004204
TCONS_00008056 other upstream 266035 30424226 ~ 30508791 (-) True XLOC_004205
TCONS_00008067 other upstream 1012158 31170349 ~ 31172254 (-) True XLOC_004210
TCONS_00008075 other upstream 2572974 32731165 ~ 32737593 (-) True XLOC_004221
TCONS_00008078 other upstream 3213060 33371251 ~ 33371367 (-) True XLOC_004227

Expression Profile


//