G260810


Basic Information

Item Value
gene id G260810
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000062
NCBI id null
chromosome length 4496499
location 3714789 ~ 3715088 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU296029
ATACACCTAGGATGGCTTGAGGGTGAGTAAATCTTTGGGTAATTTTCATTTTAAAGTGAACTAATCCTTTAAGTCTGAGTTTAAATTCCCATCTTTCATTGCAAAAGAGCAGTTCAGACATCTTGCTTAAAATTCTTTTGGGTTTCATGAGTAGATGATTTTTGGATGAACACATTTTTTTTTTAAGCTTTTCCTTTTAAACAATTAATAAAAAGCACACTTGTTACATTAAAATGTGTTTGTTCAATATTATTTGATTTACTGTTTTCAAAATTTGTGCAGCTTGGATGATGTCACAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU296029 True 300 lncRNA 0.30 1 3714789 3715088

Neighbor

gene id symbol gene type direction distance location
CI01000062_03608961_03614541 NA coding upstream 99336 3608843 ~ 3615453 (+)
CI01000062_03575943_03597236 EFR3BA, EFR3B coding upstream 116224 3575943 ~ 3598565 (+)
CI01000062_03487108_03498318 ECT2L coding upstream 215908 3487108 ~ 3498881 (+)
CI01000062_03480918_03482967 CCDC28A coding upstream 230680 3480918 ~ 3484109 (+)
CI01000062_03422781_03423731 TMEM121A, TMEM121B, TMEM121 coding upstream 290040 3421906 ~ 3424749 (+)
CI01000062_03846495_03878349 PROX1, PROX1A coding downstream 129814 3844902 ~ 3878863 (+)
CI01000062_03904672_03920716 NA coding downstream 188899 3903987 ~ 3920753 (+)
CI01000062_03927588_03933449 NA coding downstream 212500 3927588 ~ 3934032 (+)
CI01000062_03957204_03981763 KCNK2 coding downstream 241704 3956792 ~ 3981912 (+)
CI01000062_04000935_04003736 NA coding downstream 285847 4000935 ~ 4004205 (+)
G260803 NA non-coding upstream 8821 3705747 ~ 3705968 (+)
G260779 NA non-coding upstream 58338 3656213 ~ 3656451 (+)
G260768 NA non-coding upstream 75716 3638618 ~ 3639073 (+)
G260764 NA non-coding upstream 96151 3618276 ~ 3618638 (+)
G260698 NA non-coding upstream 109702 3601286 ~ 3605087 (+)
G260816 NA non-coding downstream 8023 3723111 ~ 3723497 (+)
G260819 NA non-coding downstream 12815 3727903 ~ 3728120 (+)
G260827 NA non-coding downstream 22642 3737730 ~ 3737973 (+)
G260828 NA non-coding downstream 23290 3738378 ~ 3738610 (+)
G260831 NA non-coding downstream 27938 3743026 ~ 3743226 (+)

Expression


Co-expression Network