G454960


Basic Information

Item Value
gene id G454960
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000320
NCBI id null
chromosome length 3894707
location 1884549 ~ 1884893 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU522362
TTAACCCTTTCGCACGTAAGTTTAAAATATTCTGGCTGATCCCCCAGCGTGAGTTTTTTAAGGCGACCGTTATTTAGAACGTACCACTTTATTGTTTCCATGGTGACGCGTCATTGCTTGTCACGTAAAACAGCACAGCGCTGTATGACTGATGATCTGCTTTTATTTCATCTTTCTTTTTTTATTCAAAATATTCACAAATTTGTTAACTATAGCATGAAATATCTGATATTCCGATTGTCAAATATGTGCAAGTGGATGTGTTTTGCTGTTTAAACACCTTTATAACGATCGCGTTAGTTGAGCTACATGCGCAATGGGCGCCGCCATGTTAGTTTGCGCCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU522362 True 345 lncRNA 0.39 1 1884549 1884893

Neighbor

gene id symbol gene type direction distance location
CI01000320_01719471_01731780 NA coding downstream 152673 1719306 ~ 1731876 (-)
CI01000320_01453536_01456193 ME-T, NTL, TA coding downstream 428272 1453156 ~ 1456277 (-)
CI01000320_01426753_01430603 NA coding downstream 453895 1426176 ~ 1430654 (-)
CI01000320_01394827_01394991 NA coding downstream 488450 1394798 ~ 1396099 (-)
CI01000320_01345762_01346867 NA coding downstream 537682 1345662 ~ 1346867 (-)
CI01000320_01896359_01898516 NA coding upstream 10931 1895824 ~ 1898516 (-)
CI01000320_01914015_01916289 NA coding upstream 28411 1913304 ~ 1916289 (-)
CI01000320_01996579_02046284 NA coding upstream 111465 1996358 ~ 2046284 (-)
CI01000320_02054421_02068560 PHACTR4A coding upstream 169518 2054411 ~ 2068560 (-)
CI01000320_02151521_02154094 EDN2 coding upstream 266349 2151242 ~ 2154201 (-)
G454957 NA non-coding downstream 947 1883288 ~ 1883602 (-)
G454942 NA non-coding downstream 15331 1868989 ~ 1869218 (-)
G454851 NA non-coding downstream 160840 1722972 ~ 1723709 (-)
G454840 NA non-coding downstream 182178 1702140 ~ 1702371 (-)
G454837 NA non-coding downstream 192808 1691467 ~ 1691741 (-)
G454967 NA non-coding upstream 4521 1889414 ~ 1889931 (-)
G454968 NA non-coding upstream 5264 1890157 ~ 1890384 (-)
G455623 NA non-coding upstream 14709 1899602 ~ 1902381 (-)
G455624 NA non-coding upstream 17780 1902673 ~ 1902892 (-)
G455628 NA non-coding upstream 23069 1907962 ~ 1908278 (-)
CI01000320_01338270_01341123 SH3BGRL3 other downstream 543333 1336279 ~ 1343274 (-)
G454686 NA other downstream 742669 1141242 ~ 1141880 (-)
G454663 NA other downstream 828654 1051468 ~ 1055895 (-)
G454495 NA other downstream 1355997 527059 ~ 528552 (-)
G456317 NA other upstream 1758344 3643237 ~ 3648040 (-)

Expression


Co-expression Network