G455642


Basic Information

Item Value
gene id G455642
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000320
NCBI id null
chromosome length 3894707
location 1920380 ~ 1920597 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU523099
ACTAAGGATCATGTGTAATTGGAACACATTCCAAAAGTTGAAGATTATTTATTGCATTTGGAGTTAAAGGAACAACAGGAACAATGATTAAAAAGGCACTTATGAGAATGAATGCCTTTTATAAGTTGGAATCCCATAATTATGGTAATTCTGACATGGCGTGAACACACCTATACTTATTAAACTCATCTAGACTTATCTAAACTCCAAACCTGGTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU523099 True 218 lncRNA 0.33 1 1920380 1920597

Neighbor

gene id symbol gene type direction distance location
CI01000320_01914015_01916289 NA coding downstream 4091 1913304 ~ 1916289 (-)
CI01000320_01896359_01898516 NA coding downstream 21864 1895824 ~ 1898516 (-)
CI01000320_01719471_01731780 NA coding downstream 188504 1719306 ~ 1731876 (-)
CI01000320_01453536_01456193 ME-T, NTL, TA coding downstream 464103 1453156 ~ 1456277 (-)
CI01000320_01426753_01430603 NA coding downstream 489726 1426176 ~ 1430654 (-)
CI01000320_01996579_02046284 NA coding upstream 75761 1996358 ~ 2046284 (-)
CI01000320_02054421_02068560 PHACTR4A coding upstream 133814 2054411 ~ 2068560 (-)
CI01000320_02151521_02154094 EDN2 coding upstream 230645 2151242 ~ 2154201 (-)
CI01000320_02165761_02186455 HIVEP3A coding upstream 245164 2165761 ~ 2186455 (-)
CI01000320_02201385_02204409 NA coding upstream 280527 2201124 ~ 2205644 (-)
G455628 NA non-coding downstream 12102 1907962 ~ 1908278 (-)
G455624 NA non-coding downstream 17488 1902673 ~ 1902892 (-)
G455623 NA non-coding downstream 17999 1899602 ~ 1902381 (-)
G454968 NA non-coding downstream 29996 1890157 ~ 1890384 (-)
G455656 NA non-coding upstream 13352 1933949 ~ 1934242 (-)
G455661 NA non-coding upstream 25535 1946132 ~ 1946360 (-)
G455663 NA non-coding upstream 29260 1949857 ~ 1951294 (-)
G455676 NA non-coding upstream 60149 1980746 ~ 1981056 (-)
G455681 NA non-coding upstream 129891 2050488 ~ 2122675 (-)
CI01000320_01338270_01341123 SH3BGRL3 other downstream 579164 1336279 ~ 1343274 (-)
G454686 NA other downstream 778500 1141242 ~ 1141880 (-)
G454663 NA other downstream 864485 1051468 ~ 1055895 (-)
G454495 NA other downstream 1391828 527059 ~ 528552 (-)
G456317 NA other upstream 1722640 3643237 ~ 3648040 (-)

Expression


Co-expression Network