XLOC_016299


Basic Information

Item Value
gene id XLOC_016299
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 20457947 ~ 20459009 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00033363
cactgttgtatttacagaagttttatgagaataagctacaggttgatttatactaatctgttatttttcttttttagcacgactgactgaagttttaaaatcatgcaacgtcataaagcagcagctgggcctgattctcacaaaaccaaaacagacgtgatgaaattccagatgtaaacacatttgaccttcctttggccaattggatttggaaaagcttgaaaatcaactaaaggagcagcccgaacaaatgaagaaactgatggagtgaggacaaatgtccataccacgccactgataaagaagtggaaaaatgcattacaaggtagctacaacttgcccctgacagggatggaggaagaaagaagagaaagctaatgtgtcaaatgtctacatcactattttgttttaatttttaaacaacattttaagtgtattaggatgttccctgatacttgaacaatttgtttctttcatttgcatttatatatatatatatatgtatatgtatatatatatatgtgtgtgtgtgtatatatatgtatggtatgtatgtatgtatgtgtgtgcgccaaattgtaaagaaacatcttgatacatttttaataaacgtaatacaaataaaattataaatataaaattgcacaagacgtgtatatatatgaaatttataatcatctcactcatgtcttgctgtttgtgcaattgattttgttctgcaattatttatatatatatttgtttattattattttaatgttttattaaaaaatgtttcaagatgtttcttcagaattctgcagtactttttacaagtttgacttggatattttacggattgtcattggtatttttaagatgtttcttgctatatcttaaattggtttctatatttagg

Function

GO:

id name namespace
GO:0001704 formation of primary germ layer biological_process
GO:0048731 system development biological_process
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0035775 pronephric glomerulus morphogenesis biological_process
GO:0048762 mesenchymal cell differentiation biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0072102 glomerulus morphogenesis biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0065007 biological regulation biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0060896 neural plate pattern specification biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0060897 neural plate regionalization biological_process
GO:0001756 somitogenesis biological_process
GO:0043009 chordate embryonic development biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0048785 hatching gland development biological_process
GO:0048513 animal organ development biological_process
GO:0035282 segmentation biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0003154 BMP signaling pathway involved in determination of left/right symmetry biological_process
GO:0035295 tube development biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:2000223 regulation of BMP signaling pathway involved in heart jogging biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0009887 animal organ morphogenesis biological_process
GO:0007275 multicellular organism development biological_process
GO:0009888 tissue development biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0060429 epithelium development biological_process
GO:0035050 embryonic heart tube development biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0048562 embryonic organ morphogenesis biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0048568 embryonic organ development biological_process
GO:0048856 anatomical structure development biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0021915 neural tube development biological_process
GO:0033504 floor plate development biological_process
GO:0048598 embryonic morphogenesis biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:2000826 regulation of heart morphogenesis biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0009952 anterior/posterior pattern specification biological_process
GO:0060485 mesenchyme development biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0048332 mesoderm morphogenesis biological_process
GO:0007369 gastrulation biological_process
GO:1900094 regulation of transcription from RNA polymerase II promoter involved in determination of left/right symmetry biological_process
GO:0048646 anatomical structure formation involved in morphogenesis biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0003002 regionalization biological_process
GO:0003007 heart morphogenesis biological_process
GO:0007389 pattern specification process biological_process
GO:0050789 regulation of biological process biological_process
GO:0061053 somite development biological_process
GO:0061311 cell surface receptor signaling pathway involved in heart development biological_process
GO:0050794 regulation of cellular process biological_process
GO:0061312 BMP signaling pathway involved in heart development biological_process
GO:0039021 pronephric glomerulus development biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0007417 central nervous system development biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0007420 brain development biological_process
GO:0021999 neural plate anterior/posterior regionalization biological_process
GO:0003303 BMP signaling pathway involved in heart jogging biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0060562 epithelial tube morphogenesis biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0072045 convergent extension involved in nephron morphogenesis biological_process
GO:1901213 regulation of transcription from RNA polymerase II promoter involved in heart development biological_process
GO:0060322 head development biological_process
GO:0009790 embryo development biological_process
GO:0009792 embryo development ending in birth or egg hatching biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00033363 True 898 lncRNA 0.30 2 20457947 20459009

Neighbor

gene id symbol gene type direction distance location
XLOC_016296 plppr5a coding downstream 134046 20262479 ~ 20323901 (-)
XLOC_016295 NA coding downstream 309578 20124994 ~ 20148369 (-)
XLOC_016294 dpydb coding downstream 337043 19824190 ~ 20120904 (-)
XLOC_016293 BX088713.2 coding downstream 822856 19634994 ~ 19635091 (-)
XLOC_016292 BX088713.1 coding downstream 836303 19601696 ~ 19621644 (-)
XLOC_016300 si:ch211-267e7.3 coding upstream 96385 20555394 ~ 20599315 (-)
XLOC_016301 dusp12 coding upstream 199250 20658259 ~ 20715094 (-)
XLOC_016302 AL954134.1 coding upstream 240472 20699481 ~ 20704523 (-)
XLOC_016303 FO681336.1 coding upstream 298573 20757582 ~ 20757699 (-)
XLOC_016304 CABZ01020455.1 coding upstream 304280 20763289 ~ 20788698 (-)
XLOC_016291 NA non-coding downstream 862886 19592454 ~ 19595061 (-)
XLOC_016290 BX664750.7 non-coding downstream 878268 19579582 ~ 19579679 (-)
XLOC_016311 NA non-coding upstream 663179 21122188 ~ 21124115 (-)
XLOC_016313 NA non-coding upstream 736519 21195528 ~ 21208559 (-)
XLOC_016314 CU464125.1 non-coding upstream 853733 21312742 ~ 21320684 (-)

Expression


Co-expression Network