RNA id: TCONS_00033363


Basic Information

Item Value
RNA id TCONS_00033363
length 898
lncRNA type intronic
GC content 0.30
exon number 2
gene id XLOC_016299
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 20457947 ~ 20459009 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

cactgttgtatttacagaagttttatgagaataagctacaggttgatttatactaatctgttatttttcttttttagcacgactgactgaagttttaaaatcatgcaacgtcataaagcagcagctgggcctgattctcacaaaaccaaaacagacgtgatgaaattccagatgtaaacacatttgaccttcctttggccaattggatttggaaaagcttgaaaatcaactaaaggagcagcccgaacaaatgaagaaactgatggagtgaggacaaatgtccataccacgccactgataaagaagtggaaaaatgcattacaaggtagctacaacttgcccctgacagggatggaggaagaaagaagagaaagctaatgtgtcaaatgtctacatcactattttgttttaatttttaaacaacattttaagtgtattaggatgttccctgatacttgaacaatttgtttctttcatttgcatttatatatatatatatatgtatatgtatatatatatatgtgtgtgtgtgtatatatatgtatggtatgtatgtatgtatgtgtgtgcgccaaattgtaaagaaacatcttgatacatttttaataaacgtaatacaaataaaattataaatataaaattgcacaagacgtgtatatatatgaaatttataatcatctcactcatgtcttgctgtttgtgcaattgattttgttctgcaattatttatatatatatttgtttattattattttaatgttttattaaaaaatgtttcaagatgtttcttcagaattctgcagtactttttacaagtttgacttggatattttacggattgtcattggtatttttaagatgtttcttgctatatcttaaattggtttctatatttagg

Function

GO:

id name namespace
GO:0001704 formation of primary germ layer biological_process
GO:0048731 system development biological_process
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0035775 pronephric glomerulus morphogenesis biological_process
GO:0048762 mesenchymal cell differentiation biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0072102 glomerulus morphogenesis biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0065007 biological regulation biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0060896 neural plate pattern specification biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0060897 neural plate regionalization biological_process
GO:0001756 somitogenesis biological_process
GO:0043009 chordate embryonic development biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0048785 hatching gland development biological_process
GO:0048513 animal organ development biological_process
GO:0035282 segmentation biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0003154 BMP signaling pathway involved in determination of left/right symmetry biological_process
GO:0035295 tube development biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:2000223 regulation of BMP signaling pathway involved in heart jogging biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0009887 animal organ morphogenesis biological_process
GO:0007275 multicellular organism development biological_process
GO:0009888 tissue development biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0060429 epithelium development biological_process
GO:0035050 embryonic heart tube development biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0048562 embryonic organ morphogenesis biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0048568 embryonic organ development biological_process
GO:0048856 anatomical structure development biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0021915 neural tube development biological_process
GO:0033504 floor plate development biological_process
GO:0048598 embryonic morphogenesis biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:2000826 regulation of heart morphogenesis biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0009952 anterior/posterior pattern specification biological_process
GO:0060485 mesenchyme development biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0048332 mesoderm morphogenesis biological_process
GO:0007369 gastrulation biological_process
GO:1900094 regulation of transcription from RNA polymerase II promoter involved in determination of left/right symmetry biological_process
GO:0048646 anatomical structure formation involved in morphogenesis biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0003002 regionalization biological_process
GO:0003007 heart morphogenesis biological_process
GO:0007389 pattern specification process biological_process
GO:0050789 regulation of biological process biological_process
GO:0061053 somite development biological_process
GO:0061311 cell surface receptor signaling pathway involved in heart development biological_process
GO:0050794 regulation of cellular process biological_process
GO:0061312 BMP signaling pathway involved in heart development biological_process
GO:0039021 pronephric glomerulus development biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0007417 central nervous system development biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0007420 brain development biological_process
GO:0021999 neural plate anterior/posterior regionalization biological_process
GO:0003303 BMP signaling pathway involved in heart jogging biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0060562 epithelial tube morphogenesis biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0072045 convergent extension involved in nephron morphogenesis biological_process
GO:1901213 regulation of transcription from RNA polymerase II promoter involved in heart development biological_process
GO:0060322 head development biological_process
GO:0009790 embryo development biological_process
GO:0009792 embryo development ending in birth or egg hatching biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00033803 lncRNA downstream 309578 20144257 ~ 20148369 (-) False XLOC_016295
TCONS_00033801 lncRNA downstream 309589 20124994 ~ 20148358 (-) False XLOC_016295
TCONS_00032125 lncRNA downstream 309912 20146139 ~ 20148035 (-) True XLOC_016295
TCONS_00033802 lncRNA downstream 309944 20144257 ~ 20148003 (-) False XLOC_016295
TCONS_00032118 lncRNA downstream 836303 19601696 ~ 19621644 (-) True XLOC_016292
TCONS_00032145 lncRNA upstream 460162 20919171 ~ 20920335 (-) True XLOC_016307
TCONS_00033804 lncRNA upstream 663179 21122188 ~ 21124115 (-) True XLOC_016311
TCONS_00032151 lncRNA upstream 706796 21165805 ~ 21166754 (-) True XLOC_016312
TCONS_00033805 lncRNA upstream 736519 21195528 ~ 21197037 (-) False XLOC_016313
TCONS_00033806 lncRNA upstream 736519 21195528 ~ 21208559 (-) False XLOC_016313
TCONS_00032126 mRNA downstream 134046 20262479 ~ 20323901 (-) True XLOC_016296
TCONS_00032122 mRNA downstream 337043 19824190 ~ 20120904 (-) False XLOC_016294
TCONS_00032121 mRNA downstream 337043 19824190 ~ 20120904 (-) False XLOC_016294
TCONS_00032123 mRNA downstream 405386 19825299 ~ 20052561 (-) True XLOC_016294
TCONS_00032119 mRNA downstream 827650 19628134 ~ 19630297 (-) True XLOC_016289
TCONS_00032129 mRNA upstream 96385 20555394 ~ 20599315 (-) False XLOC_016300
TCONS_00032130 mRNA upstream 97176 20556185 ~ 20574193 (-) True XLOC_016300
TCONS_00032131 mRNA upstream 199250 20658259 ~ 20667001 (-) False XLOC_016301
TCONS_00032132 mRNA upstream 201855 20660864 ~ 20666947 (-) False XLOC_016301
TCONS_00032133 mRNA upstream 202294 20661303 ~ 20666964 (-) False XLOC_016301
TCONS_00032124 other downstream 312122 20145741 ~ 20145825 (-) False XLOC_016295
TCONS_00032120 other downstream 822856 19634994 ~ 19635091 (-) True XLOC_016293
TCONS_00032117 other downstream 878268 19579582 ~ 19579679 (-) True XLOC_016290
TCONS_00032113 other downstream 898776 19539680 ~ 19559171 (-) True XLOC_016287
TCONS_00032112 other downstream 934264 19523586 ~ 19523683 (-) True XLOC_016286
TCONS_00032136 other upstream 240472 20699481 ~ 20701863 (-) False XLOC_016302
TCONS_00032137 other upstream 242079 20701088 ~ 20702736 (-) False XLOC_016302
TCONS_00032138 other upstream 243217 20702226 ~ 20704523 (-) False XLOC_016302
TCONS_00032139 other upstream 243697 20702706 ~ 20704523 (-) True XLOC_016302
TCONS_00032140 other upstream 298573 20757582 ~ 20757699 (-) True XLOC_016303

Expression Profile

//