RNA id: TCONS_00032124


Basic Information

Item Value
RNA id TCONS_00032124
length 85
RNA type miRNA
GC content 0.48
exon number 1
gene id XLOC_016295
representative False

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 20124994 ~ 20148369 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GGCTCTCTTCGGTGACGGGTATTCTTGGGTGGATAATACGGCTCTCGTTGTTATTGCTTAAGAATACGCGTAGTTGAGGAGAGTC

Function

GO:

id name namespace
GO:0042692 muscle cell differentiation biological_process
GO:0048731 system development biological_process
GO:0048468 cell development biological_process
GO:0090257 regulation of muscle system process biological_process
GO:0051146 striated muscle cell differentiation biological_process
GO:0006936 muscle contraction biological_process
GO:0006937 regulation of muscle contraction biological_process
GO:0030154 cell differentiation biological_process
GO:0006941 striated muscle contraction biological_process
GO:0010927 cellular component assembly involved in morphogenesis biological_process
GO:0055001 muscle cell development biological_process
GO:0055002 striated muscle cell development biological_process
GO:0007275 multicellular organism development biological_process
GO:0031032 actomyosin structure organization biological_process
GO:0007010 cytoskeleton organization biological_process
GO:0007015 actin filament organization biological_process
GO:0048856 anatomical structure development biological_process
GO:0045214 sarcomere organization biological_process
GO:0097435 supramolecular fiber organization biological_process
GO:0030239 myofibril assembly biological_process
GO:0048869 cellular developmental process biological_process
GO:0051017 actin filament bundle assembly biological_process
GO:0061572 actin filament bundle organization biological_process
GO:0003012 muscle system process biological_process
GO:0030029 actin filament-based process biological_process
GO:0030036 actin cytoskeleton organization biological_process
GO:0061061 muscle structure development biological_process
GO:0032501 multicellular organismal process biological_process
GO:0032502 developmental process biological_process
GO:0099080 supramolecular complex cellular_component
GO:0099081 supramolecular polymer cellular_component
GO:0043292 contractile fiber cellular_component
GO:0044430 obsolete cytoskeletal part cellular_component
GO:0030424 axon cellular_component
GO:0030426 growth cone cellular_component
GO:0030427 site of polarized growth cellular_component
GO:0044449 obsolete contractile fiber part cellular_component
GO:0036379 myofilament cellular_component
GO:0005856 cytoskeleton cellular_component
GO:0005861 troponin complex cellular_component
GO:0005865 striated muscle thin filament cellular_component
GO:0015629 actin cytoskeleton cellular_component
GO:0099512 supramolecular fiber cellular_component
GO:0033267 obsolete axon part cellular_component
GO:0044295 axonal growth cone cellular_component
GO:0031674 I band cellular_component
GO:0030016 myofibril cellular_component
GO:0030017 sarcomere cellular_component
GO:0030018 Z disc cellular_component
GO:0150034 distal axon cellular_component
GO:0043228 non-membrane-bounded organelle cellular_component
GO:0043232 intracellular non-membrane-bounded organelle cellular_component
GO:0051015 actin filament binding molecular_function
GO:0003779 actin binding molecular_function
GO:0008092 cytoskeletal protein binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000117302

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00032118 lncRNA downstream 524097 19601696 ~ 19621644 (-) True XLOC_016292
TCONS_00033360 lncRNA downstream 550680 19592454 ~ 19595061 (-) True XLOC_016291
TCONS_00032114 lncRNA downstream 580468 19560092 ~ 19565273 (-) True XLOC_016288
TCONS_00033800 lncRNA downstream 763419 19379111 ~ 19382322 (-) True XLOC_016283
TCONS_00032104 lncRNA downstream 876444 19252270 ~ 19269297 (-) True XLOC_016280
TCONS_00032125 lncRNA upstream 314 20146139 ~ 20148035 (-) True XLOC_016295
TCONS_00033361 lncRNA upstream 307789 20453614 ~ 20462923 (-) False XLOC_016298
TCONS_00033362 lncRNA upstream 310462 20456287 ~ 20462909 (-) True XLOC_016298
TCONS_00033363 lncRNA upstream 312122 20457947 ~ 20459009 (-) True XLOC_016299
TCONS_00032145 lncRNA upstream 773346 20919171 ~ 20920335 (-) True XLOC_016307
TCONS_00032122 mRNA downstream 24837 19824190 ~ 20120904 (-) False XLOC_016294
TCONS_00032121 mRNA downstream 24837 19824190 ~ 20120904 (-) False XLOC_016294
TCONS_00032123 mRNA downstream 93180 19825299 ~ 20052561 (-) True XLOC_016294
TCONS_00032116 mRNA downstream 515444 19574650 ~ 19630297 (-) False XLOC_016289
TCONS_00032119 mRNA downstream 515444 19628134 ~ 19630297 (-) True XLOC_016289
TCONS_00032126 mRNA upstream 116654 20262479 ~ 20323901 (-) True XLOC_016296
TCONS_00032127 mRNA upstream 298652 20444477 ~ 20470125 (-) False XLOC_016297
TCONS_00032128 mRNA upstream 302409 20448234 ~ 20470140 (-) True XLOC_016297
TCONS_00032129 mRNA upstream 409569 20555394 ~ 20599315 (-) False XLOC_016300
TCONS_00032130 mRNA upstream 410360 20556185 ~ 20574193 (-) True XLOC_016300
TCONS_00032120 other downstream 510650 19634994 ~ 19635091 (-) True XLOC_016293
TCONS_00032117 other downstream 566062 19579582 ~ 19579679 (-) True XLOC_016290
TCONS_00032113 other downstream 586570 19539680 ~ 19559171 (-) True XLOC_016287
TCONS_00032112 other downstream 622058 19523586 ~ 19523683 (-) True XLOC_016286
TCONS_00032108 other downstream 632445 19506311 ~ 19513296 (-) False XLOC_016284
TCONS_00032136 other upstream 553656 20699481 ~ 20701863 (-) False XLOC_016302
TCONS_00032137 other upstream 555263 20701088 ~ 20702736 (-) False XLOC_016302
TCONS_00032138 other upstream 556401 20702226 ~ 20704523 (-) False XLOC_016302
TCONS_00032139 other upstream 556881 20702706 ~ 20704523 (-) True XLOC_016302
TCONS_00032140 other upstream 611757 20757582 ~ 20757699 (-) True XLOC_016303