G53395 (cacna1d)


Basic Information

Item Value
gene id G53395
gene name cacna1d
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053116.1
NCBI id CM020913.1
chromosome length 44101041
location 26750010 ~ 26753039 (-)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU71390
GTTGGCCTGTTGGAGGCTCGAGGAGAAGGTAAAATCCATTTCCTGGGTGACCGCTTGCCGTCTTGGTAGATGGGCAGTTGGTCATCGTCATAGTAACCATCAGACTGGTGGTCACCCTTGGAAACCTCGAGGTCAAAGCCTCCCTCTGCATCATGGTGTTCCTTGTTGGGCAACCTGTCCTTTGGGAGCATGATGTCATCTTCGTGAAACTCCTCCCCGCTGAAGTACTCTCCCGAGCCTCGCTCATCATCGCTGTCCACGCCCCCTGGCTCCTCTCGACGAATGGTGGGGTAGAGCCCACCGCCGCTTTCTGACCTAATGTAGG

Function

symbol description
cacna1d Enables alpha-actinin binding activity and voltage-gated calcium channel activity involved SA node cell action potential. Contributes to high voltage-gated calcium channel activity. Involved in several processes, including cardiac conduction; cardiac muscle cell action potential involved in contraction; and sensory perception of sound. Part of L-type voltage-gated calcium channel complex. Implicated in type 2 diabetes mellitus. Biomarker of type 2 diabetes mellitus.

NR:

description
PREDICTED: voltage-dependent L-type calcium channel subunit alpha-1D

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU71390 True 325 lncRNA 0.56 4 26750010 26753039

Neighbor

gene id symbol gene type direction distance location
LOC120559562 tkt coding downstream 105430 26627296 ~ 26644580 (-)
LOC120559020 LOC104941497 coding downstream 265226 26476362 ~ 26484784 (-)
si:dkey-11f4.7 LOC104941497,LOC103384507,LOC102293335 coding downstream 273935 26444951 ~ 26476075 (-)
LOC120559754 prelid3b,LOC102797510,LOC100690371 coding downstream 307365 26435683 ~ 26442645 (-)
actr5 actr5,LOC102798407 coding downstream 335029 26408194 ~ 26414981 (-)
chdh chdh coding upstream 12050 26765089 ~ 26775805 (-)
sema3b sema3b coding upstream 236761 26989800 ~ 27076351 (-)
zgc:136971 NA coding upstream 393464 27146503 ~ 27156987 (-)
amt amt coding upstream 418634 27171673 ~ 27183156 (-)
LOC120559022 NA coding upstream 440243 27193282 ~ 27202420 (-)
G53382 LOC103362754,LOC107086658,LOC100689745,LOC101161804,LOC104940874,LOC105936371 non-coding downstream 86325 26620041 ~ 26663685 (-)
G53366 NA non-coding downstream 155132 26591029 ~ 26594878 (-)
G53359 LOC104943886 non-coding downstream 174731 26574152 ~ 26575279 (-)
LOC120559888 NA non-coding downstream 179038 26570591 ~ 26570972 (-)
G53352 chmp4b,LOC107390603,LOC107086700,LOC106511320 non-coding downstream 207383 26539907 ~ 26542627 (-)
G53398 NA non-coding upstream 43452 26796491 ~ 26797207 (-)
LOC120559916 NA non-coding upstream 44366 26797405 ~ 26801154 (-)
LOC120559521 NA non-coding upstream 63978 26817017 ~ 26818570 (-)
LOC120558995 NA non-coding upstream 460493 27213532 ~ 27215246 (-)
G53540 NA non-coding upstream 500569 27253608 ~ 27255158 (-)
dcp1a dcp1a other downstream 91689 26646814 ~ 26658321 (-)
LOC120559114 LOC101164642,LOC104966947,LOC100690915,LOC104926428,LOC102195969,LOC101062277 other downstream 347700 26392012 ~ 26402310 (-)
G53196 NA other downstream 535128 26212993 ~ 26214882 (-)
emc1 NA other downstream 602765 26136998 ~ 26147245 (-)
acot7 acot7,LOC102782704 other downstream 777688 25910755 ~ 25972322 (-)
selenok selenok other upstream 39413 26792452 ~ 26795090 (-)
G53444 sema3g other upstream 208308 26961347 ~ 26966023 (-)
ifrd2 ifrd2,LOC104928016,LOC104966933 other upstream 404549 27157588 ~ 27171232 (-)
hyal3 LOC103359396 other upstream 436009 27189048 ~ 27199911 (-)
xpc xpc other upstream 891744 27644783 ~ 27660646 (-)

Expression


Co-expression Network