G51261 (eif4b)


Basic Information

Item Value
gene id G51261
gene name eif4b
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 10839106 ~ 10839672 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU64148
CCTCTCCCTGGGCCGCCGCTCGGGTGCTCTGCCCTTGTCCTCCTCCAGCTGCCTCTGCAGCCTCTCCTGCTCCTTTTTCAGGCGCTCCTCCACCTCGCGCTCCTTGGCCGCGGTGTCCACGGGCTTCGCCCCTCCGAAGATGGAGGCTGCGCGGCCCGTCTGTGTGGGGGGCACAACCCGGTCCTCCTCCTTGGGCACGCTGCGGGGCTTCAGCTGGAGCTTGGGCCTCTGCAGTGGGCCTGTCCCACCTCTATCGTCACGGCGCTCATCCTTGCGCTCGTAACGTTCTTCGCGTTCCCCGTACCGGTCGCCATAGCGATCTGCACTGCCCCGGAAATTGTCACGTCCGTCGTCGTTGTCACGCCTGAACCCGCTGCCGAAAGCCCGCCGGCTGCCACCGCGAGAGTCGAATCCTGGGGAGTGTAGGACAAGACAAGGGCTCAAACAACGCAAACAGTTTCCCCATCCTAGTCCAGGG

Function

symbol description
eif4b Enables RNA binding activity. Predicted to be involved in eukaryotic translation initiation factor 4F complex assembly and formation of translation preinitiation complex. Located in cytosol. Biomarker of autism spectrum disorder and major depressive disorder.

NR:

description
PREDICTED: eukaryotic translation initiation factor 4B isoform X4

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU64148 True 478 lncRNA 0.65 2 10839106 10839672

Neighbor

gene id symbol gene type direction distance location
AMCG00008751 krt8,LOC105023875,LOC107551542,LOC108411779,LOC107681390 coding downstream 67452 10764016 ~ 10771654 (-)
AMCG00008750 e3,LOC108429286,LOC106565226,LOC107705699 coding downstream 113930 10719492 ~ 10725176 (-)
AMCG00008747 NA coding downstream 176915 10655011 ~ 10662191 (-)
AMCG00008743 LOC103045919,LOC106565233,LOC102299085,LOC100696631,LOC102216220 coding downstream 349340 10472530 ~ 10489766 (-)
AMCG00008739 NA coding downstream 581255 10221420 ~ 10257851 (-)
AMCG00008756 NA coding upstream 118912 10958584 ~ 10972379 (-)
AMCG00008765 NA coding upstream 164484 11004156 ~ 11011571 (-)
AMCG00008763 pcbp2,LOC100691124,LOC103464415,LOC106956729 coding upstream 181876 11021548 ~ 11035727 (-)
AMCG00008761 NA coding upstream 198630 11038302 ~ 11044119 (-)
AMCG00008764 NA coding upstream 205291 11044963 ~ 11051426 (-)
G51251 krt18,LOC107727028,LOC107551541,LOC100692632,LOC102212553 non-coding downstream 35397 10801108 ~ 10803709 (-)
G51243 NA non-coding downstream 165251 10668711 ~ 10673855 (-)
G51120 NA non-coding downstream 908004 9927245 ~ 9931102 (-)
G51103 LOC106928590,LOC103386378,LOC107385311,LOC106514726 non-coding downstream 928306 9909611 ~ 9910800 (-)
G51081 NA non-coding downstream 1099850 9738646 ~ 9739256 (-)
G51344 NA non-coding upstream 218005 11057677 ~ 11140273 (-)
G51354 LOC100846954 non-coding upstream 323674 11163346 ~ 11164374 (-)
G51403 NA non-coding upstream 386815 11226487 ~ 11258218 (-)
G51574 NA non-coding upstream 1163253 12002925 ~ 12010394 (-)
G51588 NA non-coding upstream 1241540 12081212 ~ 12093785 (-)
G51250 NA other downstream 39952 10797632 ~ 10799154 (-)
AMCG00008748 LOC107666380,LOC108429286,LOC107705699,LOC107681386,LOC107559866 other downstream 120905 10670949 ~ 10718201 (-)
G51241 NA other downstream 126621 10675756 ~ 10712485 (-)
AMCG00008744 NA other downstream 235733 10560866 ~ 10603373 (-)
AMCG00008741 hdac7,LOC107704627,LOC107752451 other downstream 468790 10338325 ~ 10370316 (-)
AMCG00008777 dctn2,LOC102785932 other upstream 395970 11235642 ~ 11326359 (-)
AMCG00008815 NA other upstream 1761619 12601291 ~ 12605260 (-)
G51797 NA other upstream 2051139 12890811 ~ 12891597 (-)
G51799 NA other upstream 2055663 12895335 ~ 12897134 (-)
G51867 NA other upstream 2161154 13000826 ~ 13001888 (-)

Expression


Co-expression Network