G18171


Basic Information

Item Value
gene id G18171
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 7799030 ~ 7799626 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU20427
AAACAAAACACCGGCCATGAATTAGAAGTCTAAAATGATCATTTTTAAAGAGAAATGTCGGAGGATTTCGATAGAAGAGGAGAGAAGCTTGAGTTTGTTGCCCAGCCACATTTGTTTGAACCGTGAGAGGCGTCTAAGCTCACGATACTACTACATCCTACGTCCTACATCGCGTCAGGGGGTTACTCATTTGGCGCAAGTCGATTTGCGCAGTATGAGTAAGGTCGTCCGCCGGAAGCTAGTTATTTGTTTGTATGAAAGAAGATAGTCATATACACCAAGGATTGCTTGAGGGAGCCTTTGTAGCCAAACTACGTTGGCTTTTGGATGGTTTGCTTTACCAGCACATTGCATTGGCATACTGTAATTTGAACAGAGCCAGTGGCGATTCAGATCCCAGATCTACAGAGAGGCTCAGAGGAATATCTCAGCTGGAGGGGCCCGTGCAGGAAGAACACCCAGCTGAACACAATGTGGGATCGGCTATGAGCTAATTGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU20427 True 498 lncRNA 0.39 2 7799030 7799626

Neighbor

gene id symbol gene type direction distance location
CI01000001_07769921_07796135 NA coding downstream 2483 7769089 ~ 7796547 (-)
CI01000001_07609855_07631058 NA coding downstream 167745 7609820 ~ 7631285 (-)
CI01000001_07568083_07573146 CA6 coding downstream 225691 7568083 ~ 7573339 (-)
CI01000001_07565885_07567962 NA coding downstream 231068 7565370 ~ 7567962 (-)
CI01000001_07492000_07496973 SPSB1, SPSB4 coding downstream 302057 7491422 ~ 7496973 (-)
CI01000001_07807093_07808245 NA coding upstream 6287 7805913 ~ 7808493 (-)
CI01000001_07875805_07905655 NOC2L coding upstream 76112 7875738 ~ 7905655 (-)
CI01000001_07953501_07958007 NA coding upstream 153607 7953233 ~ 7958007 (-)
CI01000001_08036532_08037745 HER9, HES4 coding upstream 236600 8036226 ~ 8038004 (-)
CI01000001_08109635_08112413 NA coding upstream 309984 8109610 ~ 8112517 (-)
G18141 NA non-coding downstream 61546 7728123 ~ 7737484 (-)
G17950 NA non-coding downstream 210557 7586506 ~ 7588473 (-)
G17951 NA non-coding downstream 212932 7584537 ~ 7586098 (-)
G18017 NA non-coding downstream 223895 7574901 ~ 7575135 (-)
G18222 NA non-coding upstream 106899 7906525 ~ 7906850 (-)
G18239 NA non-coding upstream 135528 7935154 ~ 7935374 (-)
G18243 NA non-coding upstream 169824 7969450 ~ 7969723 (-)
G18248 NA non-coding upstream 176358 7975984 ~ 7976201 (-)
G18023 NA other downstream 41510 7756501 ~ 7757520 (-)
G17911 NA other downstream 545776 7251311 ~ 7267952 (-)
CI01000001_06932075_06937182 NA other downstream 861807 6931621 ~ 6937231 (-)
G17789 NA other downstream 908616 6837525 ~ 6890414 (-)
G16753 NA other downstream 1183441 6583054 ~ 6615589 (-)
G18223 NA other upstream 126478 7926104 ~ 7928517 (-)
CI01000001_09804494_09811219 NA other upstream 2010031 9804429 ~ 9811219 (-)
G20136 NA other upstream 2739401 10539027 ~ 10539850 (-)
CI01000001_10862471_10864514 NA other upstream 3062599 10862225 ~ 10865770 (-)
G20230 NA other upstream 3222501 11022127 ~ 11028777 (-)

Expression


Co-expression Network