G27166


Basic Information

Item Value
gene id G27166
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 4410444 ~ 4411305 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU30665
TAGAGGGGGTGTTTTGGGTCTTGCCGTTCTTTCCTTTTAAGAGAGACATTGAATGTGTAACACTGAAGACACTCCAACACTACAATGACAAGGAGCTGGACTCATACCTGGGGTTTTACTGGGGGTTTTGGAAAGGCTCACTGATCTGCTGATGCTCTTGTTTGGTGAGAGGGAGTTTGTGTTGGTGGAGTTGGAAGTGCTGGCTTTCCTCTGCCACCTCGCCATCGGGGCGTTTGTGATAGGCATGTCCAGCCGGAGGACATTGTGAATGTCATTCTCAAACCCAAACTGGGACATTACTGCTACAGCGATGGTCAACTCCAAATCCAGCAACTTCGTTCCTCTGAAGCACAAATAAATTGTTAATAAAATGTAGCCGCTCTTGTTTATGTACAACTTTCCTGCTTTCTTCGTCCTTCCACAAGCAGAGTTAAGTCTCATCTGAGCAGGTGAAGACAGTTAACGGATGAACGCCAGTTTAAATGTCTTAAACTCGTGTCGTGATTGGAGAATTCAAAAAACAAAAGTTTTCGCTGTTACCAAGGCAGCCAGGCAGAATGCTGCGCGATGATTGGTGAATCGCATCATTAAGTACTTCCTGACAGCATTACATATTAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU30665 True 619 lncRNA 0.40 2 4410444 4411305

Neighbor

gene id symbol gene type direction distance location
CI01000004_04400735_04404462 ELOVL1A coding upstream 5658 4400422 ~ 4404786 (+)
CI01000004_04315741_04317415 GLULB, GLULA, GLNA, GS02, GLUL, GS01, GS04 coding upstream 92828 4314776 ~ 4317616 (+)
CI01000004_04231304_04239652 NA coding upstream 170321 4231211 ~ 4240123 (+)
CI01000004_04172679_04173047 PBX1 coding upstream 236092 4171654 ~ 4174352 (+)
CI01000004_04123289_04123846 NA coding upstream 286481 4122624 ~ 4123963 (+)
CI01000004_04412723_04413196 NA coding downstream 296 4411601 ~ 4413196 (+)
CI01000004_04414110_04428551 CC2D1B coding downstream 2805 4414110 ~ 4428551 (+)
CI01000004_04498877_04532504 CLCN2, CLCN2A coding downstream 87572 4498877 ~ 4533086 (+)
CI01000004_04535801_04536013 NA coding downstream 123953 4535258 ~ 4536509 (+)
CI01000004_04690908_04706755 ATP1B3A coding downstream 279603 4690908 ~ 4706900 (+)
G27146 NA non-coding upstream 54900 4355317 ~ 4355544 (+)
G27138 NA non-coding upstream 75114 4335045 ~ 4335330 (+)
G27133 NA non-coding upstream 89076 4321159 ~ 4321368 (+)
G27044 NA non-coding upstream 242195 4168046 ~ 4168249 (+)
G27027 NA non-coding upstream 311726 4098327 ~ 4098718 (+)
G27159 NA non-coding downstream 24876 4436181 ~ 4436502 (+)
G27147 NA non-coding downstream 49813 4461118 ~ 4657333 (+)
G27149 NA non-coding downstream 150852 4562157 ~ 4574162 (+)
G27176 NA non-coding downstream 174250 4585555 ~ 4589326 (+)
G27254 NA non-coding downstream 239101 4650406 ~ 4676215 (+)
CI01000004_03550525_03552621 PTGER4C other upstream 857998 3550329 ~ 3553423 (+)
G26245 NA other upstream 888051 3509017 ~ 3522393 (+)
CI01000004_02745885_02768971 NA other upstream 1651506 2745885 ~ 2769135 (+)
G25992 NA other upstream 1673676 2736536 ~ 2736768 (+)
G25882 NA other upstream 1837395 2548075 ~ 2573049 (+)
G27805 NA other downstream 961520 5372825 ~ 5373803 (+)
G28165 NA other downstream 1321284 5732589 ~ 5733001 (+)
G28302 NA other downstream 2058723 6470028 ~ 6502087 (+)
CI01000004_06571261_06572539 SEP15 other downstream 2159915 6570771 ~ 6572667 (+)
CI01000004_07654234_07655677 MRPL34 other downstream 3243467 7654234 ~ 7656383 (+)

Expression


Co-expression Network