G30272



Basic Information


Item Value
gene id G30272
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 9274499 ~ 9274752 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU34258
AAAATGAAAATTTGATGTTTATCTGCTTACCCCCAGGGCATCCAAGATGTAGGTGACTTTGTTTCTTCAGTAGAACACAAATAATGATTTTTAACTCCAACCGTTGCGGTCTGTCAGTCGTATAATGCATGTCAATGGGAACTCCATCTATAAGAGTAAAAAAAAAACACGCACAGACAAATCCAAATTAAACCCTGCGGCTCGTGACGACACATTGATGTCCTAAGACACGAAACGATCGGTTTGTGCGAGAT

Function


NR:

description
PREDICTED: NACHT, LRR and PYD domains-containing protein 3-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU34258 True 254 lncRNA 0.43 1 9274499 9274752

Neighbor


gene id symbol gene type direction distance location
CI01000004_09179343_09182737 NA coding downstream 90781 9177975 ~ 9183718 (-)
CI01000004_09159241_09169070 NA coding downstream 102782 9158475 ~ 9171717 (-)
CI01000004_09006723_09020870 NA coding downstream 253629 9006723 ~ 9020870 (-)
CI01000004_08958415_08969605 U2SURP coding downstream 304894 8958279 ~ 8969605 (-)
CI01000004_08953993_08957525 TMEM59 coding downstream 316974 8953852 ~ 8957525 (-)
CI01000004_09324170_09327754 DSELA coding upstream 48794 9323546 ~ 9327754 (-)
CI01000004_09329111_09337596 NA coding upstream 54234 9328986 ~ 9337596 (-)
CI01000004_09367511_09370243 TOE1 coding upstream 92709 9367461 ~ 9370243 (-)
CI01000004_09425074_09426973 NA coding upstream 150215 9424967 ~ 9428395 (-)
CI01000004_09486618_09488654 UROD, DCUP coding upstream 211605 9486357 ~ 9488654 (-)
G30108 NA non-coding downstream 11664 9262628 ~ 9262835 (-)
G30101 NA non-coding downstream 17183 9257050 ~ 9257316 (-)
G30096 NA non-coding downstream 23514 9250767 ~ 9250985 (-)
G30092 NA non-coding downstream 28541 9245751 ~ 9245958 (-)
G30091 NA non-coding downstream 29452 9244824 ~ 9245047 (-)
G30276 NA non-coding upstream 4968 9279720 ~ 9279930 (-)
G30280 NA non-coding upstream 30638 9305390 ~ 9305624 (-)
G30316 NA non-coding upstream 103185 9377937 ~ 9406921 (-)
G30369 NA non-coding upstream 383172 9657924 ~ 9658522 (-)
G30370 NA non-coding upstream 383996 9658748 ~ 9659060 (-)
G29746 NA other downstream 916372 8354498 ~ 8358127 (-)
G29656 NA other downstream 1308999 7964364 ~ 7965500 (-)
G29388 NA other downstream 2642592 6631293 ~ 6631907 (-)
CI01000004_06539836_06541252 NA other downstream 2728927 6538904 ~ 6541252 (-)
CI01000004_05617072_05627369 NA other downstream 3646985 5616644 ~ 5628289 (-)
G31203 NA other upstream 1471685 10746437 ~ 10750641 (-)
CI01000004_11407198_11412220 ADCYAP1B, ADCYAP1 other upstream 2132713 11406957 ~ 11412907 (-)
G32150 NA other upstream 2501767 11776519 ~ 11780951 (-)
G32207 NA other upstream 3101416 12376168 ~ 12384780 (-)

Expression



Co-expression Network