G32798



Basic Information


Item Value
gene id G32798
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 12965870 ~ 12966103 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU37195
GACAATGGACAAAGGCAGGTGGATAAGACGAATGCAGTAGTCTACAAGACAAACACATCTCTGTAGCCTATAACCACCGTTAACCACCAATAATCGCAATAAGCTCTGCGTTTTGTTACTTTTGATAAGAAACAAAGTGTCATCTTTCAAATTCTGTCCATTTTAACACGAAATTCAAACAGAGAATCCCGTTTTGACGCTCTTTAAAGTGGCACAACATAAGCGCAGTTCAAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU37195 True 234 lncRNA 0.30 1 12965870 12966103

Neighbor


gene id symbol gene type direction distance location
CI01000004_12952019_12956814 ATP6V0B coding downstream 9056 12951759 ~ 12956814 (-)
CI01000004_12823734_12925962 B4GALT2 coding downstream 39908 12823734 ~ 12925962 (-)
CI01000004_12781663_12809789 NA coding downstream 156081 12781525 ~ 12809789 (-)
CI01000004_12748162_12752913 NA coding downstream 212595 12747939 ~ 12753275 (-)
CI01000004_12574165_12577698 NA coding downstream 385691 12574085 ~ 12580179 (-)
CI01000004_13086552_13088659 NA coding upstream 118721 13084824 ~ 13088898 (-)
CI01000004_13089864_13091636 NA coding upstream 122480 13088583 ~ 13091669 (-)
CI01000004_13094468_13114401 PTCH2 coding upstream 127483 13093586 ~ 13114998 (-)
CI01000004_13127356_13168751 EI2BG, EIF2B3 coding upstream 161253 13127356 ~ 13168751 (-)
CI01000004_13208157_13210917 CENPL coding upstream 241778 13207881 ~ 13210917 (-)
G32720 NA non-coding downstream 44336 12913214 ~ 12921534 (-)
G32701 NA non-coding downstream 184380 12775782 ~ 12781490 (-)
G32707 NA non-coding downstream 252694 12707058 ~ 12713176 (-)
G32606 NA non-coding downstream 310043 12600800 ~ 12655827 (-)
G32810 NA non-coding upstream 16353 12982456 ~ 12982781 (-)
G32822 NA non-coding upstream 33039 12999142 ~ 13000643 (-)
G32823 NA non-coding upstream 36128 13002231 ~ 13002542 (-)
G32710 NA non-coding upstream 79716 13045819 ~ 13046163 (-)
G32715 NA non-coding upstream 80159 13046262 ~ 13046911 (-)
G32207 NA other downstream 581090 12376168 ~ 12384780 (-)
G32150 NA other downstream 1184919 11776519 ~ 11780951 (-)
CI01000004_11407198_11412220 ADCYAP1B, ADCYAP1 other downstream 1552963 11406957 ~ 11412907 (-)
G31203 NA other downstream 2215229 10746437 ~ 10750641 (-)
G30316 NA other downstream 3558949 9377937 ~ 9406921 (-)
CI01000004_14543631_14551256 NA other upstream 1584697 14541515 ~ 14551352 (-)
G33746 NA other upstream 1602690 14568793 ~ 14569264 (-)
G33750 NA other upstream 1612355 14578458 ~ 14579001 (-)
G33755 NA other upstream 1615303 14581406 ~ 14581873 (-)
G33756 NA other upstream 1619068 14585171 ~ 14585745 (-)

Expression



Co-expression Network