CI01000005_03050086_03051694 (TUBA3E, TUBA1C, BRAFLDRAFT_115374, TUBA1A, TUBA4, TUBA4L, TUBA1B, TUBA4A, TUBA1A.L)



Basic Information


Item Value
gene id CI01000005_03050086_03051694
gene name TUBA3E, TUBA1C, BRAFLDRAFT_115374, TUBA1A, TUBA4, TUBA4L, TUBA1B, TUBA4A, TUBA1A.L
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000005
NCBI id null
chromosome length 7630583
location 3050086 ~ 3051694 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>CI01000005_03050086_03051694.mRNA
ATGGCTTCCAGCCAGATGGGACCATTGTTGGTGATGGAAGCTCATTGGTTGACTCCTCTTTTGGCACTTTCTTCAGTGAAACTGGTGCTGGGAAATGAGATCCGTAATGGACACTATCGACAGCTGTACCACCCTGAGCAGCTCATCAGTGGCAAGGAGGATGCTGCCAATAATTATGCTCGTGGTCACTATACCATTGGCAAAGAGATTGTAGACTCCGTGCTCGACCGGATGCGCAAAATGGCGGACCAGTGCACCGGTCTGCAGGGGTTCCTGATCTTCCACAGTTTTGGTGGAGGAACAGGCTCTGGTTTCACATCTCTGCTGATGGAGCGATTGTCTGTCGATTACGGTAAAAAGTCAAAGTTGGAGTTCTCTGTGTATCCTGCCCCACAAGTCAGCACGGCTGTGGTTGAGCCCTACAACTCGATCCTTACGACCCACACCACTCTCGAGCACTCGGACTGCTCCTTCATGGTGGATAACGAAGCCATCTTTGACATCTGTAAGCGAAACCTCGATATCGAGCGTCCCTCATACACTAACCTGAACAGGCTCATCGCCCAGATTGTGTCCTCCATTACGGCGTCACTGCGCTTTGACGGTGCGCTAAACGTTGACCTCACGGAGTTCCAGACCAACCTGGTCCCGTACCCTCGCATTCACTTTCCATTGGTCACCTACTCCCCCATCATTTCGGCCGAAAAGGCCTACCATGAGCAGCTCTCCGTACCGGAGATCACCAATGCCTGCTTCGAGCCAGCAAACCAGATGGTGAAGTGTGACCCTCGCCGTGGAAAATACATGGCCTGCTGTTTGCTGTACCGTGGTGATGTGGTTCCGAAAGATGTCAATGCTGCCATAGCCAACATCAAGACGAGGCGCTCCATCCAGTTTGTAGACTGGTGTCCGACTGGGTTTAAGGTCGGAATCAACTACCAGCCGCCCACCGTCGTGCCAGGAGGGGATCTGGCCAAAGTGCAGAGAGCTGTCTGCATGCTAAGCAACACCACTGCCATCGCAGAAGCATGGGGCCGCCTGGACCACAAGTTTGACCTGATGTATGCAAAGAGGGCTTTTGTTCACTGGTACGTGGGTGAAGGGATGGAGGAAGGGGAGTTCTCGGAGGCTCGGGAAGACATGGCTGCACTGGAGAAAGACTATGAGGAG

Function


symbol description
tuba1b Predicted to enable GTP binding activity. Predicted to be a structural constituent of cytoskeleton. Predicted to be involved in microtubule cytoskeleton organization and mitotic cell cycle. Predicted to act upstream of or within microtubule-based process. Predicted to be located in cytoskeleton. Predicted to be active in cytoplasm and microtubule. Is expressed in several structures, including ectoderm; integument; nervous system; neural tube; and pleuroperitoneal region. Orthologous to human TUBA1B (tubulin alpha 1b).
tuba4l Predicted to enable GTP binding activity. Predicted to be a structural constituent of cytoskeleton. Predicted to be involved in microtubule cytoskeleton organization and mitotic cell cycle. Predicted to act upstream of or within microtubule-based process. Predicted to be located in cytoskeleton. Predicted to be active in cytoplasm and microtubule. Orthologous to human TUBAL3 (tubulin alpha like 3).
tuba1c Predicted to enable GTP binding activity. Predicted to be a structural constituent of cytoskeleton. Predicted to be involved in microtubule cytoskeleton organization and mitotic cell cycle. Predicted to act upstream of or within microtubule-based process. Predicted to be located in cytoskeleton. Predicted to be active in cytoplasm and microtubule. Is expressed in central nervous system; forebrain; nervous system; neurons; and peripheral nervous system. Orthologous to several human genes including TUBA1B (tubulin alpha 1b).
tuba1a Predicted to enable GTP binding activity. Predicted to be a structural constituent of cytoskeleton. Acts upstream of or within negative regulation of apoptotic process and optic nerve formation. Predicted to be located in cytoskeleton. Predicted to be active in cytoplasm and microtubule. Human ortholog(s) of this gene implicated in lissencephaly; lissencephaly 3; microcephaly; and visual epilepsy. Orthologous to human TUBA1A (tubulin alpha 1a).
tuba4a Enables protein kinase binding activity. Predicted to be involved in microtubule cytoskeleton organization and mitotic cell cycle. Located in microtubule. Implicated in amyotrophic lateral sclerosis type 22.
tuba3e Predicted to enable GTP binding activity. Predicted to be a structural constituent of cytoskeleton. Predicted to be involved in microtubule cytoskeleton organization and mitotic cell cycle. Located in microtubule cytoskeleton.

NR:

description
Tubulin, alpha 4 like

GO:

id name namespace
GO:0005200 structural constituent of cytoskeleton molecular_function

KEGG:

id description
K07374 TUBA; tubulin alpha

RNA


RNA id representative length rna type GC content exon number start site end site
CI01000005_03050086_03051694.mRNA True 1170 mRNA 0.53 3 3050086 3051694

Neighbor


gene id symbol gene type direction distance location
CI01000005_03044395_03046540 TUBA3E, TUBA3D, TUBA1C, TUBA4, TUBA4L, TUBA8L, TUBA4A, TUBA1A.L coding downstream 3282 3044363 ~ 3046804 (-)
CI01000005_02940731_02974087 SYNDIG1 coding downstream 75915 2940257 ~ 2974171 (-)
CI01000005_02885300_02890664 NA coding downstream 159422 2884930 ~ 2890664 (-)
CI01000005_02761667_02765877 DLL1, DLD coding downstream 283746 2761272 ~ 2766340 (-)
CI01000005_02669952_02699226 ACTR2B, ACTR2, ACTR2.S, ACTR2A coding downstream 350860 2669114 ~ 2699226 (-)
CI01000005_03163226_03166158 MEA1 coding upstream 110424 3162118 ~ 3166158 (-)
CI01000005_03175712_03183326 NA coding upstream 123888 3175582 ~ 3183326 (-)
CI01000005_03384625_03397017 LRRC73 coding upstream 332656 3384350 ~ 3397017 (-)
CI01000005_03400313_03405169 NA coding upstream 348600 3400294 ~ 3405169 (-)
CI01000005_03412228_03417948 YIPF3, YIPF3.L coding upstream 360309 3412003 ~ 3418657 (-)
G37815 NA non-coding downstream 38142 3009599 ~ 3011944 (-)
G37799 NA non-coding downstream 131436 2918298 ~ 2918650 (-)
G37798 NA non-coding downstream 142527 2907168 ~ 2907559 (-)
G37742 NA non-coding downstream 174974 2867131 ~ 2875112 (-)
G37861 NA non-coding upstream 39338 3091032 ~ 3091255 (-)
G37867 NA non-coding upstream 65600 3117294 ~ 3144925 (-)
G37904 NA non-coding upstream 183718 3235412 ~ 3236020 (-)
G37906 NA non-coding upstream 191944 3243638 ~ 3243856 (-)
G37936 NA non-coding upstream 233446 3285140 ~ 3285803 (-)
CI01000005_01883894_01899867 NA other downstream 1160810 1883222 ~ 1899867 (-)
G36628 NA other downstream 1385807 1663267 ~ 1664279 (-)
G36049 NA other downstream 2006414 1021295 ~ 1043672 (-)
G38510 NA other upstream 1153151 4204845 ~ 4206208 (-)
G38415 NA other upstream 1329544 4381238 ~ 4401110 (-)
G39515 NA other upstream 2782098 5833792 ~ 5834539 (-)
CI01000005_06481721_06483251 NA other upstream 3428995 6481355 ~ 6483265 (-)
G40487 NA other upstream 4144101 7195795 ~ 7196428 (-)

Expression



Co-expression Network