G37694



Basic Information


Item Value
gene id G37694
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000005
NCBI id null
chromosome length 7630583
location 2597274 ~ 2597528 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU42742
ATTTGCATGTGGTTGTTGTGTACAAGAAATGTTATAAAAGTGAGTTGACATACACAATTTATTAGAGCAGCTGTCGATGTGGCAGGTGTGTTCATCAAACATAAATATTTTAAAATTTTTATAAGTTGGCATTATTCCTTTTTCACTGGCGGGTCTCCCAGGCAGATGCAGCATCTTCAGTCACGGGAAAACCCCTTAACTGTTAAAAGGACAAGATAATACATCGGATATTTAAACAGATTTTTTATTATGAAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU42742 True 255 lncRNA 0.35 1 2597274 2597528

Neighbor


gene id symbol gene type direction distance location
CI01000005_02403966_02437498 NA coding downstream 159735 2403955 ~ 2437539 (-)
CI01000005_02312170_02375877 MEIS2, MEIS1 coding downstream 221397 2312170 ~ 2375877 (-)
CI01000005_02240553_02245892 NA coding downstream 350439 2239837 ~ 2246835 (-)
CI01000005_02163205_02167196 NA coding downstream 430078 2162428 ~ 2167196 (-)
CI01000005_01944678_01957016 NA coding downstream 640258 1943961 ~ 1957016 (-)
CI01000005_02619187_02639895 SPRED2B, SPRED2 coding upstream 20557 2618085 ~ 2639895 (-)
CI01000005_02669952_02699226 ACTR2B, ACTR2, ACTR2.S, ACTR2A coding upstream 71586 2669114 ~ 2699226 (-)
CI01000005_02761667_02765877 DLL1, DLD coding upstream 163744 2761272 ~ 2766340 (-)
CI01000005_02885300_02890664 NA coding upstream 287402 2884930 ~ 2890664 (-)
CI01000005_02940731_02974087 SYNDIG1 coding upstream 342729 2940257 ~ 2974171 (-)
G37688 NA non-coding downstream 2654 2594394 ~ 2594620 (-)
G37554 NA non-coding downstream 171986 2425012 ~ 2425288 (-)
G37544 NA non-coding downstream 182041 2414854 ~ 2415233 (-)
G37536 NA non-coding downstream 191828 2405194 ~ 2405446 (-)
G37468 NA non-coding downstream 214914 2380494 ~ 2382360 (-)
G37695 NA non-coding upstream 157 2597685 ~ 2597971 (-)
G37698 NA non-coding upstream 3342 2600870 ~ 2601071 (-)
G37690 NA non-coding upstream 7072 2604600 ~ 2605243 (-)
G37691 NA non-coding upstream 9024 2606552 ~ 2606839 (-)
G37723 NA non-coding upstream 144099 2741627 ~ 2742083 (-)
CI01000005_01883894_01899867 NA other downstream 707998 1883222 ~ 1899867 (-)
G36628 NA other downstream 932995 1663267 ~ 1664279 (-)
G36049 NA other downstream 1553602 1021295 ~ 1043672 (-)
G38510 NA other upstream 1607317 4204845 ~ 4206208 (-)
G38415 NA other upstream 1783710 4381238 ~ 4401110 (-)
G39515 NA other upstream 3236264 5833792 ~ 5834539 (-)
CI01000005_06481721_06483251 NA other upstream 3883161 6481355 ~ 6483265 (-)
G40487 NA other upstream 4598267 7195795 ~ 7196428 (-)

Expression



Co-expression Network