G40553


Basic Information

Item Value
gene id G40553
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000005
NCBI id null
chromosome length 7630583
location 7368986 ~ 7369202 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU46026
TGAACGCTGCTACCCAAACCAACATCCTCACACACATTCTCTGTCAGAGCAATGTCATCATGCACAACGTCTTGAGCAACAAAGGCCTGGTCAGATGTGTCTTCCATCATCATGACATTGCTCTGATTGGCAGCAAGGCTGTTGGCACTACTCCCATTGTCTACATATGCAACCTCCTCATTACTATTTACAGCAGAAATAGGGATGCCACTTACCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU46026 True 217 lncRNA 0.36 1 7368986 7369202

Neighbor

gene id symbol gene type direction distance location
CI01000005_07355833_07360372 NA coding downstream 8614 7355833 ~ 7360372 (-)
CI01000005_07190084_07218097 NA coding downstream 150853 7189596 ~ 7218133 (-)
CI01000005_07143500_07144465 NA coding downstream 224421 7143482 ~ 7144565 (-)
CI01000005_07111233_07112234 NA coding downstream 256720 7110722 ~ 7112266 (-)
CI01000005_07093538_07094533 NA coding downstream 274417 7093482 ~ 7094569 (-)
CI01000005_07373961_07374634 NA coding upstream 4208 7373410 ~ 7374634 (-)
CI01000005_07398684_07399164 MPC1.S, MPC1, MPC1.L coding upstream 29285 7398487 ~ 7399164 (-)
CI01000005_07436839_07437813 NA coding upstream 66863 7436065 ~ 7438424 (-)
CI01000005_07591912_07592984 NA coding upstream 222710 7591912 ~ 7592991 (-)
CI01000005_07593934_07596058 RPS27A, DENND5B coding upstream 224724 7593926 ~ 7596058 (-)
G40551 NA non-coding downstream 3832 7364797 ~ 7365154 (-)
G40550 NA non-coding downstream 4898 7363876 ~ 7364088 (-)
G40539 NA non-coding downstream 25782 7338826 ~ 7343204 (-)
G40549 NA non-coding downstream 41747 7327035 ~ 7327239 (-)
G40547 NA non-coding downstream 42834 7325882 ~ 7326152 (-)
G40543 NA non-coding upstream 16258 7385460 ~ 7392722 (-)
G40564 NA non-coding upstream 56509 7425711 ~ 7425966 (-)
G40566 NA non-coding upstream 58497 7427699 ~ 7427912 (-)
G40580 NA non-coding upstream 89619 7458821 ~ 7468238 (-)
G40585 NA non-coding upstream 112321 7481523 ~ 7481722 (-)
G40487 NA other downstream 172558 7195795 ~ 7196428 (-)
CI01000005_06481721_06483251 NA other downstream 885497 6481355 ~ 6483265 (-)
G39515 NA other downstream 1534447 5833792 ~ 5834539 (-)
G38415 NA other downstream 2967876 4381238 ~ 4401110 (-)
G38510 NA other downstream 3162778 4204845 ~ 4206208 (-)
G40540 NA other upstream 157019 7526221 ~ 7532148 (-)

Expression


Co-expression Network