G43449



Basic Information


Item Value
gene id G43449
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 4010017 ~ 4010320 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU49317
AGAAGCGGTCAGGTTTTGATTTTTATCTGTTAGTATTTGATAGAATCCATGATACCATGTATCTGAACAAGATGTCCAGGACCTCCAGCAGAAAAATAGGCCCACAACATTAAAGATCCAGCAGTATATTTAACCGTGGGCATGGGGTACTTTTTACCCTGTGTGCACCAAACCCATCCGGTGGGTTTGCTGCCAAAAAGCTCTTTTTTTAGTTTCATCTGACCATAGAAGCCGGTCCCGTTTGAAGTTCCAGTCGTGTCTGACAACTGAATATGCTGGAGATTGTTTCTGGATGAGAGCAGAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU49317 True 304 lncRNA 0.43 1 4010017 4010320

Neighbor


gene id symbol gene type direction distance location
CI01000006_03853517_03857679 ADSSL, PURA2 coding downstream 152338 3853517 ~ 3857679 (-)
CI01000006_03850934_03852259 NA coding downstream 157713 3850934 ~ 3852304 (-)
CI01000006_03841667_03847765 STX5AL, STX5 coding downstream 162252 3841321 ~ 3847765 (-)
CI01000006_03814498_03821222 NA coding downstream 188795 3814433 ~ 3821222 (-)
CI01000006_03782744_03792823 ESRRA coding downstream 216733 3782699 ~ 3793284 (-)
CI01000006_04131548_04142994 SUPT6H coding upstream 121040 4131360 ~ 4142994 (-)
CI01000006_04144468_04144836 NA coding upstream 134148 4144468 ~ 4145103 (-)
CI01000006_04154152_04182430 CALN2, CALN1 coding upstream 143775 4154095 ~ 4182430 (-)
CI01000006_04232222_04238240 NF2B, NF2 coding upstream 221588 4231908 ~ 4238240 (-)
CI01000006_04244321_04245262 NA coding upstream 233574 4243894 ~ 4247214 (-)
G43212 NA non-coding downstream 59343 3949274 ~ 3950674 (-)
G43190 NA non-coding downstream 64297 3925935 ~ 3945720 (-)
G43220 NA non-coding downstream 121312 3887906 ~ 3888705 (-)
G43393 NA non-coding downstream 130366 3879028 ~ 3879651 (-)
G43383 NA non-coding downstream 143820 3865945 ~ 3866197 (-)
G43453 NA non-coding upstream 3755 4014075 ~ 4014297 (-)
G43468 NA non-coding upstream 18939 4029259 ~ 4029572 (-)
G43500 NA non-coding upstream 86335 4096655 ~ 4096894 (-)
G43513 NA non-coding upstream 152462 4162782 ~ 4163072 (-)
G43516 NA non-coding upstream 155995 4166315 ~ 4166578 (-)
G43102 NA other downstream 1076033 2908451 ~ 2933984 (-)
CI01000006_02624725_02626124 COX8A other downstream 1383831 2624436 ~ 2626776 (-)
G42934 NA other downstream 1427811 2523776 ~ 2582206 (-)
CI01000006_02285649_02294759 NA other downstream 1715019 2284994 ~ 2296494 (-)
G42667 NA other downstream 2119261 1888988 ~ 1890756 (-)
G43549 NA other upstream 342190 4352510 ~ 4355428 (-)
CI01000006_04560607_04560993 NA other upstream 549189 4559509 ~ 4562068 (-)
CI01000006_06974359_06976736 NA other upstream 2962904 6973224 ~ 6976872 (-)
CI01000006_07500281_07507754 NA other upstream 3492825 7500246 ~ 7507976 (-)
CI01000006_10453630_10483241 NA other upstream 6472536 10453613 ~ 10484006 (-)

Expression



Co-expression Network