G41807



Basic Information


Item Value
gene id G41807
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 4179000 ~ 4179252 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU47453
AATCTTCATTAACGTTAGTTAATGAAAATACAGTTGTTCATTGTTTGTTCATTGTTTGTTAGTTCACAGTGCATTAACTAATGTTAAGGTGCAATATGTAATATTTTCTGTCCGCTAGAGGTCGCTACAGGCCTATTCAAAACAAAGGCGTAGCTTGATGACGCCAAGTTTGAGCGCGGAATCTTGGGACATGTGGTCTTCACCTCAACGGCCGGTGGAAAAGAATTGGGATTGGACTCGGGAAGAAATCATG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU47453 True 253 lncRNA 0.37 1 4179000 4179252

Neighbor


gene id symbol gene type direction distance location
CI01000006_04145907_04147044 SDF2 coding upstream 29826 4145414 ~ 4149174 (+)
CI01000006_04124413_04127728 RAB34 coding upstream 51229 4124413 ~ 4127771 (+)
CI01000006_04107814_04117460 TLCD1 coding upstream 61338 4107814 ~ 4117662 (+)
CI01000006_04100433_04105606 NIPAL4 coding upstream 73383 4100062 ~ 4105617 (+)
CI01000006_04050327_04089669 GRIA1B coding upstream 87677 4048960 ~ 4091323 (+)
CI01000006_04240020_04242545 WBSCR27 coding downstream 60768 4240020 ~ 4242978 (+)
CI01000006_04257954_04258376 NA coding downstream 77571 4256823 ~ 4258506 (+)
CI01000006_04268235_04268891 CLDNC coding downstream 86384 4265636 ~ 4269257 (+)
CI01000006_04272263_04272907 CLDNH coding downstream 92869 4272121 ~ 4273578 (+)
CI01000006_04284763_04290722 ABHD11 coding downstream 105084 4284336 ~ 4291717 (+)
G41806 NA non-coding upstream 6379 4172349 ~ 4172621 (+)
G41804 NA non-coding upstream 18635 4160081 ~ 4160365 (+)
G41767 NA non-coding upstream 34376 4142087 ~ 4144624 (+)
G41763 NA non-coding upstream 55774 4121278 ~ 4123226 (+)
G41774 NA non-coding upstream 83782 4094316 ~ 4095218 (+)
G41808 NA non-coding downstream 3823 4183075 ~ 4183315 (+)
G41810 NA non-coding downstream 9068 4188320 ~ 4188545 (+)
G41777 NA non-coding downstream 9942 4189194 ~ 4189818 (+)
G41822 NA non-coding downstream 49182 4228434 ~ 4228792 (+)
G41823 NA non-coding downstream 49585 4228837 ~ 4229231 (+)
CI01000006_03734862_03735227 BANF1, BANF1.S, BANF1.L other upstream 443022 3734554 ~ 3736035 (+)
G41591 NA other upstream 1339579 2836167 ~ 2839421 (+)
G41424 NA other upstream 1518430 2645662 ~ 2660570 (+)
G41170 NA other upstream 2483179 1692065 ~ 1695821 (+)
G40768 NA other upstream 3685974 488407 ~ 493026 (+)
G41996 NA other downstream 937954 5117206 ~ 5124149 (+)
G43896 NA other downstream 1590837 5770089 ~ 5771775 (+)
CI01000006_06104927_06109730 NA other downstream 1929232 6104927 ~ 6109820 (+)
CI01000006_06122278_06122736 NA other downstream 1942783 6122035 ~ 6122751 (+)
CI01000006_07167131_07168925 NA other downstream 2987537 7166778 ~ 7168925 (+)

Expression



Co-expression Network