G43573


Basic Information

Item Value
gene id G43573
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 4368400 ~ 4368617 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU49461
TGAGCTCATCATTTCCCTGCTGGAGTTACACTAGGCTAAATTCACACTTATCATTTGACAATACACTACATGCCGTTATAATTAACACACAGATCCTTTCACACACATAGCAGTAATAAATCAGACGCTGACTCAAATAGATCTTCCTACTCGTTTCGCCATTGTTCCAAAACAAGTGTGAGATGACCAGTCCATTGATGAAATTATGTTAATGAGTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU49461 True 218 lncRNA 0.38 1 4368400 4368617

Neighbor

gene id symbol gene type direction distance location
CI01000006_04339683_04341206 NA coding downstream 27194 4339505 ~ 4341206 (-)
CI01000006_04327754_04330520 NA coding downstream 37722 4327124 ~ 4330678 (-)
CI01000006_04322555_04322827 NA coding downstream 44039 4322468 ~ 4324361 (-)
CI01000006_04313539_04316100 NA coding downstream 52300 4313406 ~ 4316100 (-)
CI01000006_04295568_04304414 NA coding downstream 63532 4295357 ~ 4304868 (-)
CI01000006_04394840_04398849 NA coding upstream 25863 4394480 ~ 4400466 (-)
CI01000006_04480549_04481514 NA coding upstream 111575 4480192 ~ 4481514 (-)
CI01000006_04484340_04489922 OR132-5, OR132-1 coding upstream 115193 4483810 ~ 4489922 (-)
CI01000006_04524286_04525219 TMEM45B coding upstream 155362 4523979 ~ 4526098 (-)
CI01000006_04535347_04535742 SYCN coding upstream 166600 4535217 ~ 4535753 (-)
G43546 NA non-coding downstream 516 4367084 ~ 4367884 (-)
G43539 NA non-coding downstream 94486 4264964 ~ 4273914 (-)
G43525 NA non-coding downstream 165143 4203051 ~ 4203257 (-)
G43522 NA non-coding downstream 186116 4182080 ~ 4182284 (-)
CI01000006_04154152_04182430 CALN2, CALN1 non-coding downstream 186670 4154095 ~ 4182430 (-)
G43578 NA non-coding upstream 14680 4383297 ~ 4384353 (-)
G43582 NA non-coding upstream 17663 4386280 ~ 4386480 (-)
G43588 NA non-coding upstream 32873 4401490 ~ 4401755 (-)
G43628 NA non-coding upstream 65080 4433697 ~ 4437947 (-)
G43643 NA non-coding upstream 110791 4479408 ~ 4479622 (-)
G43549 NA other downstream 12972 4352510 ~ 4355428 (-)
G43102 NA other downstream 1434416 2908451 ~ 2933984 (-)
CI01000006_02624725_02626124 COX8A other downstream 1742214 2624436 ~ 2626776 (-)
G42934 NA other downstream 1786194 2523776 ~ 2582206 (-)
CI01000006_02285649_02294759 NA other downstream 2073402 2284994 ~ 2296494 (-)
CI01000006_04560607_04560993 NA other upstream 190892 4559509 ~ 4562068 (-)
CI01000006_06974359_06976736 NA other upstream 2604607 6973224 ~ 6976872 (-)
CI01000006_07500281_07507754 NA other upstream 3134528 7500246 ~ 7507976 (-)
CI01000006_10453630_10483241 NA other upstream 6114239 10453613 ~ 10484006 (-)
G47658 NA other upstream 6662294 11030911 ~ 11033127 (-)

Expression


Co-expression Network