G127445


Basic Information

Item Value
gene id G127445
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000026
NCBI id null
chromosome length 17172400
location 1776968 ~ 1777201 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU144802
AGCCAGAGCGCTGGCAGAGGCTTTCCCCTGTGGAGCACCTCCATGTCAGGCACGCAGGCCCACGGAAGTCCTTATGCCATTGGTGGAATTCTGCCTCAAACGTACCACTTCAAAGATTAACTGAACAGCTAAAGGACAACCTCCTGGTAAAAGCGGACAACCTCTATGTTTTCATACAGGTCATTTTACTCTCCCTGATGTCTTCCCCCACTTATTCCCTGCGTATTATTCCCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU144802 True 234 lncRNA 0.50 1 1776968 1777201

Neighbor

gene id symbol gene type direction distance location
CI01000026_01604062_01608083 NA coding upstream 167801 1604003 ~ 1609167 (+)
CI01000026_01587300_01603806 CYP26B1 coding upstream 173162 1587300 ~ 1603806 (+)
CI01000026_01516754_01566669 EXOC6B coding upstream 208632 1516359 ~ 1568336 (+)
CI01000026_01479116_01511199 EXOC6B coding upstream 265650 1479116 ~ 1511318 (+)
CI01000026_01449646_01450471 NA coding upstream 326497 1448858 ~ 1450471 (+)
CI01000026_01961557_01976089 NA coding downstream 183769 1960970 ~ 1976089 (+)
CI01000026_02039441_02068942 NA coding downstream 259744 2036945 ~ 2070666 (+)
CI01000026_02080994_02090637 MTM1 coding downstream 303460 2080661 ~ 2090637 (+)
CI01000026_02097643_02120853 MTMR1A coding downstream 320253 2097454 ~ 2121455 (+)
CI01000026_02150810_02194735 ARRB2, ARRB2B coding downstream 372839 2150040 ~ 2196065 (+)
G127444 NA non-coding upstream 1611 1775080 ~ 1775357 (+)
G127436 NA non-coding upstream 16197 1760465 ~ 1760771 (+)
G127417 NA non-coding upstream 40841 1735867 ~ 1736127 (+)
G127405 NA non-coding upstream 60689 1715662 ~ 1716279 (+)
G127402 NA non-coding upstream 64302 1712379 ~ 1712666 (+)
G127450 NA non-coding downstream 29679 1806880 ~ 1807310 (+)
G127467 NA non-coding downstream 67649 1844850 ~ 1845176 (+)
G127469 NA non-coding downstream 70542 1847743 ~ 1848005 (+)
G127459 NA non-coding downstream 85073 1862274 ~ 1862733 (+)
G127464 NA non-coding downstream 89382 1866583 ~ 1868173 (+)
CI01000026_00776867_00777588 NEDD8, BRAFLDRAFT_284180, NEDD8L, NEDD8.S other upstream 999171 776757 ~ 777830 (+)
G126556 NA other upstream 1021805 754791 ~ 755163 (+)
G127500 NA other downstream 153982 1931183 ~ 1946439 (+)
G127531 NA other downstream 532121 2309322 ~ 2312135 (+)
G127519 NA other downstream 616482 2393683 ~ 2427006 (+)
CI01000026_02659356_02660297 NA other downstream 882014 2658605 ~ 2660829 (+)
G127979 NA other downstream 1975350 3752551 ~ 3762986 (+)

Expression


Co-expression Network