G141734


Basic Information

Item Value
gene id G141734
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 4885987 ~ 4886187 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU161053
CCTCTTCCTGCTTTCCTAGCACAAAGATTTTTCAAGAAAACATAACATTTGAAAATAAATAGGACTAAATAAATAATAATAATTATTATTATTATAGTTTTTAATAATGATAATAATAAATAGAATTTGTATTATTGTATAATTAAATATTGATAAAGAATAATTAATGATTAATTATACTACGGGGGCTGCTGAATGCTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU161053 True 201 lncRNA 0.21 1 4885987 4886187

Neighbor

gene id symbol gene type direction distance location
CI01000027_04812648_04813272 NA coding downstream 72110 4812622 ~ 4813877 (-)
CI01000027_04750483_04762663 TRIM46, TRIM46A coding downstream 123324 4750320 ~ 4762663 (-)
CI01000027_04744526_04745444 NA coding downstream 139289 4744358 ~ 4746698 (-)
CI01000027_04603997_04606475 NA coding downstream 278193 4603444 ~ 4608289 (-)
CI01000027_04524446_04527464 NA coding downstream 358523 4523811 ~ 4527464 (-)
CI01000027_04988247_04994680 RPS27.1, RPS27, RPS27.2, RPS27.L, RPS27L coding upstream 102047 4988234 ~ 4994680 (-)
CI01000027_05037013_05040668 OSGIN2 coding upstream 149000 5035187 ~ 5040668 (-)
CI01000027_05047401_05048081 NA coding upstream 161106 5047293 ~ 5048081 (-)
CI01000027_05110063_05126542 NA coding upstream 223876 5110063 ~ 5126542 (-)
CI01000027_05196462_05200451 RPS19, RPS19-PS4, RPS19.S, RPS19-PS6, RS19 coding upstream 310262 5196431 ~ 5200451 (-)
G141731 NA non-coding downstream 2086 4883680 ~ 4883901 (-)
G141730 NA non-coding downstream 4332 4881443 ~ 4881655 (-)
G141727 NA non-coding downstream 10324 4875221 ~ 4875663 (-)
G141650 NA non-coding downstream 12220 4873119 ~ 4873767 (-)
G141695 NA non-coding downstream 90248 4785854 ~ 4795739 (-)
G141768 NA non-coding upstream 120808 5006995 ~ 5009205 (-)
G141591 NA non-coding upstream 180899 5067086 ~ 5174582 (-)
G141592 NA non-coding upstream 183249 5069436 ~ 5070830 (-)
G141597 NA non-coding upstream 195376 5081563 ~ 5083276 (-)
G141728 NA other downstream 8221 4877067 ~ 4877766 (-)
G141488 NA other downstream 377016 4507475 ~ 4508971 (-)
G141481 NA other downstream 473177 4372247 ~ 4412810 (-)
CI01000027_03922380_03931033 NA other downstream 960415 3922242 ~ 3931033 (-)
CI01000027_03787377_03788902 NA other downstream 1096765 3787377 ~ 3790279 (-)
G141588 NA other upstream 222148 5108335 ~ 5201155 (-)
CI01000027_05447458_05450346 PON2, PON3.2, PON3.1 other upstream 563139 5447424 ~ 5450461 (-)
G141638 NA other upstream 1902440 6788627 ~ 6796707 (-)
G142203 NA other upstream 2254907 7141094 ~ 7143063 (-)
G142209 NA other upstream 2267436 7153623 ~ 7157998 (-)

Expression


Co-expression Network