CI01000027_04988247_04994680 (RPS27.1, RPS27, RPS27.2, RPS27.L, RPS27L)


Basic Information

Item Value
gene id CI01000027_04988247_04994680
gene name RPS27.1, RPS27, RPS27.2, RPS27.L, RPS27L
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 4988234 ~ 4994680 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000027_04988247_04994680.mRNA
CTCGCGAAGGACTTGTTGCACCCAACGCCAGAGGAGGAGAAGAGAAGACACAAGAAGAAGCGTCTCGTACAGAGTCCCAACTCTTACTTTATGGATGTCAAATGCCCAGGCTGTTATAAGATCACTACGGTGTTCAGTCACGCACAGACGGTCGTCTTATGTGTAGGATGCTCTACAGTGCTGTGCCAGCCTACCGGAGGAAAGGCACGCCTCACAGAAGAATCAGAAATTAAACCTCTTGTGTGTGACTCTACCTATGAAAAGTGCAGCGGTGGTGGCCAGTACAGCAAAAAGAGCAAATATCGAAATGAACAAAAGCCCAAAATTTGTTCCAAGGTCACCTGAACATACAAATAAA

Function

symbol description
rps27.1 Predicted to enable RNA binding activity. Predicted to be a structural constituent of ribosome. Acts upstream of or within erythrocyte differentiation. Predicted to be located in ribosome. Predicted to be part of cytosolic small ribosomal subunit. Human ortholog(s) of this gene implicated in Diamond-Blackfan anemia 17. Orthologous to human RPS27 (ribosomal protein S27).
rps27.2 Predicted to enable RNA binding activity. Predicted to be a structural constituent of ribosome. Predicted to be involved in ribosomal small subunit assembly. Predicted to act upstream of or within translation. Predicted to be located in ribosome. Predicted to be part of cytosolic small ribosomal subunit. Human ortholog(s) of this gene implicated in Diamond-Blackfan anemia 17. Orthologous to human RPS27 (ribosomal protein S27).
rps27l Predicted to enable RNA binding activity. Predicted to be a structural constituent of ribosome. Predicted to be involved in ribosomal small subunit assembly. Predicted to act upstream of or within translation. Predicted to be located in ribosome. Predicted to be part of cytosolic small ribosomal subunit. Orthologous to human RPS27L (ribosomal protein S27 like).
rps27 A structural constituent of ribosome. Involved in rRNA processing. Located in cytosolic ribosome and nucleus. Part of cytosolic small ribosomal subunit. Is active in postsynaptic density. Implicated in Diamond-Blackfan anemia 17.

GO:

id name namespace
GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay biological_process

KEGG:

id description
K02978 RP-S27e, RPS27; small subunit ribosomal protein S27e

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000027_04988247_04994680.mRNA False 358 mRNA 0.47 3 4988234 4994680

Neighbor

gene id symbol gene type direction distance location
CI01000027_04812648_04813272 NA coding downstream 174357 4812622 ~ 4813877 (-)
CI01000027_04750483_04762663 TRIM46, TRIM46A coding downstream 225571 4750320 ~ 4762663 (-)
CI01000027_04744526_04745444 NA coding downstream 241536 4744358 ~ 4746698 (-)
CI01000027_04603997_04606475 NA coding downstream 380440 4603444 ~ 4608289 (-)
CI01000027_04524446_04527464 NA coding downstream 460770 4523811 ~ 4527464 (-)
CI01000027_05037013_05040668 OSGIN2 coding upstream 40507 5035187 ~ 5040668 (-)
CI01000027_05047401_05048081 NA coding upstream 52613 5047293 ~ 5048081 (-)
CI01000027_05110063_05126542 NA coding upstream 115383 5110063 ~ 5126542 (-)
CI01000027_05196462_05200451 RPS19, RPS19-PS4, RPS19.S, RPS19-PS6, RS19 coding upstream 201769 5196431 ~ 5200451 (-)
CI01000027_05215497_05251776 CADM4 coding upstream 220117 5214797 ~ 5251776 (-)
G141734 NA non-coding downstream 102047 4885987 ~ 4886187 (-)
G141731 NA non-coding downstream 104333 4883680 ~ 4883901 (-)
G141730 NA non-coding downstream 106579 4881443 ~ 4881655 (-)
G141727 NA non-coding downstream 112571 4875221 ~ 4875663 (-)
G141650 NA non-coding downstream 114467 4873119 ~ 4873767 (-)
G141768 NA non-coding upstream 12315 5006995 ~ 5009205 (-)
G141591 NA non-coding upstream 72406 5067086 ~ 5174582 (-)
G141592 NA non-coding upstream 74756 5069436 ~ 5070830 (-)
G141597 NA non-coding upstream 86883 5081563 ~ 5083276 (-)
G141588 NA non-coding upstream 135502 5108335 ~ 5201155 (-)
G141728 NA other downstream 110468 4877067 ~ 4877766 (-)
G141488 NA other downstream 479263 4507475 ~ 4508971 (-)
G141481 NA other downstream 575424 4372247 ~ 4412810 (-)
CI01000027_03922380_03931033 NA other downstream 1062662 3922242 ~ 3931033 (-)
CI01000027_03787377_03788902 NA other downstream 1199012 3787377 ~ 3790279 (-)
CI01000027_05447458_05450346 PON2, PON3.2, PON3.1 other upstream 454646 5447424 ~ 5450461 (-)
G141638 NA other upstream 1793947 6788627 ~ 6796707 (-)
G142203 NA other upstream 2146414 7141094 ~ 7143063 (-)
G142209 NA other upstream 2158943 7153623 ~ 7157998 (-)

Expression


Co-expression Network