G152349


Basic Information

Item Value
gene id G152349
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 2450784 ~ 2451070 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU173036
TGTGTTCCTAAGACATATAGGCAGTGTCACTGGAGGAGTATTAGAAACCATAATTATTGTTCTTATGCTATACGCCCCATAGTGGCGCAGTAATTTCAGACACTGTAAACTGCCCTTTTACAATGATTTTTTACTGTACACTGTTCACAGTACCTTTTAAAGACCCCACGATTTGGGTTAATGAATGCTTCCTGTTTTTATTATTTTTTTAAATTAGGGTGGGACACACTTTTAAAAACCAATAGAGTGCTGCAGCAATGATGTATTTTTATAGGCCAAAACCTGGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU173036 True 287 lncRNA 0.37 1 2450784 2451070

Neighbor

gene id symbol gene type direction distance location
CI01000029_02432238_02441531 NA coding upstream 9195 2432238 ~ 2441589 (+)
CI01000029_02427134_02429596 NA coding upstream 20689 2426098 ~ 2430095 (+)
CI01000029_02343103_02352351 NA coding upstream 98002 2340949 ~ 2352782 (+)
CI01000029_02192568_02196383 HDDC2 coding upstream 254093 2191911 ~ 2196691 (+)
CI01000029_02102219_02105661 ESCO2 coding upstream 344758 2102070 ~ 2106026 (+)
CI01000029_02488613_02490983 NA coding downstream 37280 2488350 ~ 2491371 (+)
CI01000029_02583370_02587687 SERINC1.L, SERC1, SERINC1, SERINC1.S coding downstream 132300 2583370 ~ 2587697 (+)
CI01000029_02684591_02727897 NA coding downstream 231449 2682519 ~ 2728167 (+)
CI01000029_02750295_02751549 NA coding downstream 296912 2747982 ~ 2751558 (+)
CI01000029_02772065_02813214 TBC1D32 coding downstream 320995 2772065 ~ 2814491 (+)
G152348 NA non-coding upstream 1051 2449414 ~ 2449733 (+)
G152347 NA non-coding upstream 24790 2425763 ~ 2425994 (+)
G152297 NA non-coding upstream 163894 2286534 ~ 2286890 (+)
G152266 NA non-coding upstream 198275 2252305 ~ 2252509 (+)
G152262 NA non-coding upstream 200928 2249655 ~ 2249856 (+)
G152281 NA non-coding downstream 31315 2482385 ~ 2484946 (+)
G152359 NA non-coding downstream 38018 2489088 ~ 2489513 (+)
G152373 NA non-coding downstream 76005 2527075 ~ 2527375 (+)
G152374 NA non-coding downstream 76746 2527816 ~ 2528163 (+)
CI01000029_01526863_01527414 NA other upstream 922885 1526754 ~ 1527899 (+)
G151495 NA other upstream 2078862 366541 ~ 371922 (+)
G151415 NA other upstream 2225539 170521 ~ 225245 (+)
G152451 NA other downstream 310524 2761594 ~ 2762939 (+)
G153475 NA other downstream 1094055 3545125 ~ 3562004 (+)
G153790 NA other downstream 2282519 4733589 ~ 4740107 (+)
G154587 NA other downstream 2819950 5271020 ~ 5271535 (+)
CI01000029_05461497_05468985 BATF other downstream 3006171 5461497 ~ 5470346 (+)

Expression


Co-expression Network