G163632


Basic Information

Item Value
gene id G163632
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 8874451 ~ 8875105 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU185909
CGTAGGTCCAAATGTCCACTGTATTAAATCATGTTTCTGTGAATCAGAAACACCAGTTTGTAGAGTAACAGAATCTCCTTTTTTCTTGTTTTCTAACCCTGCAAAGATCACATCATGGACAGTAACACTGAATGTATTGACTAAGGTCTCTGTACTGATGATTTTTAGATGATAATCTCCAGAGTGTTTGGTTCTGATGTCACTGATGGTCAAAGATCCAGTCTGATTGTCCAACTGCAGTCTGTCTTCGAATCTCCCATCATCAACGTCATATAACGAGACTGTCTGAGTTGTGCCCTGGATTTTAGCGATAATGGAGTTTTGAGATCCATACATCCACATCAACAGAAATATTCTCTGTATTTCGGTGACATTAGATGGTAGAATGACAGAATCTCCCTCCTTCACTGACACT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU185909 True 415 lncRNA 0.40 2 8874451 8875105

Neighbor

gene id symbol gene type direction distance location
CI01000030_08825422_08836502 NA coding downstream 37324 8825241 ~ 8837127 (-)
CI01000030_08804429_08811448 NA coding downstream 61881 8804270 ~ 8812570 (-)
CI01000030_08742145_08754205 NA coding downstream 118850 8742040 ~ 8755601 (-)
CI01000030_08729507_08739473 NA coding downstream 134936 8728693 ~ 8739515 (-)
CI01000030_08704610_08727738 NA coding downstream 146697 8704532 ~ 8727754 (-)
CI01000030_08880986_08884756 TMPRSS12, CELA1 coding upstream 5848 8880953 ~ 8884771 (-)
CI01000030_08919811_08923927 NA coding upstream 44450 8919555 ~ 8923927 (-)
CI01000030_08934545_08939716 NA coding upstream 59138 8934141 ~ 8939719 (-)
CI01000030_09038299_09059689 NA coding upstream 163143 9038248 ~ 9060020 (-)
CI01000030_09176691_09178066 NA coding upstream 301540 9176645 ~ 9178066 (-)
G163610 NA non-coding downstream 73885 8800207 ~ 8800566 (-)
G163598 NA non-coding downstream 87515 8786674 ~ 8786936 (-)
G163605 NA non-coding downstream 91519 8782692 ~ 8782932 (-)
G163603 NA non-coding downstream 92428 8781738 ~ 8782023 (-)
G163586 NA non-coding downstream 122667 8751423 ~ 8751784 (-)
G163872 NA non-coding upstream 57400 8932505 ~ 8933347 (-)
G163875 NA non-coding upstream 60036 8935141 ~ 8935887 (-)
G163970 NA non-coding upstream 274539 9149644 ~ 9150346 (-)
G163971 NA non-coding upstream 290829 9165934 ~ 9168180 (-)
CI01000030_08185866_08194632 NA other downstream 681965 8184897 ~ 8197266 (-)
CI01000030_07788973_07791700 TUSC2B, TUSC2 other downstream 1082069 7788797 ~ 7792198 (-)
CI01000030_07736031_07737720 LSM7.L, GM13182, LSM7 other downstream 1136447 7735436 ~ 7737720 (-)
G163139 NA other downstream 1724307 7149474 ~ 7150144 (-)
G163065 NA other downstream 1948794 6924483 ~ 6925657 (-)
G163873 NA other upstream 58308 8933413 ~ 8933982 (-)
CI01000030_09277337_09294501 NA other upstream 412101 9276431 ~ 9294802 (-)
G164071 NA other upstream 600083 9475188 ~ 9476264 (-)
CI01000030_10103451_10131419 NA other upstream 1240410 10102944 ~ 10133765 (-)

Expression


Co-expression Network