CI01000032_00932336_00974922 (GRIA3B, GRIA3)


Basic Information

Item Value
gene id CI01000032_00932336_00974922
gene name GRIA3B, GRIA3
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000032
NCBI id null
chromosome length 4185905
location 932336 ~ 974922 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000032_00932336_00974922.mRNA
ATGGCTCAAAGCGCGCTGCTTTTTTTATTATGGCTATTCGGCACATCTCTCGCTGGCTTCCCCAATCAGATAAATATCGGTGGGCTCTTCATGCGTTCCACCGTGCAAGAACACAGCGCTTTCAGATTCGCTGTGCAGCTCTACAACACCAATCAGAACATGACTGAGAAACCCTTCCATCTCAATTACAACGTAGATAACCTGGAGTCATCCAACAGTTTCTCTGTCACTCATGCATTTTGTTCGCAGTTCTCCAGAGGGGTGTACGCCATCTTCGGCTTTTATGACAAGAAGTCTATGAACACGCTGACCTCCTTCTGCGGAGCCCTCCACACCTCCTTCGTCACACCCAGCTACCCCATCGACTCAGACGTGCAGTTTGTCATCCAGATGCGCCCTCCTTTGAAGGGCGCCGTCCTGAGTCTCCTGTCTCACTACAAGTGGGACAAGTTTGTCTACCTCTATGACACAGACAGAGGTAAGTCC

Function

symbol description
gria3b Predicted to enable AMPA glutamate receptor activity. Predicted to act upstream of or within ion transport. Predicted to be located in postsynaptic membrane. Predicted to be integral component of membrane. Predicted to be part of AMPA glutamate receptor complex. Predicted to be active in dendritic spine and plasma membrane. Is expressed in nervous system. Human ortholog(s) of this gene implicated in syndromic X-linked intellectual disability 94. Orthologous to human GRIA3 (glutamate ionotropic receptor AMPA type subunit 3).
gria3 Enables AMPA glutamate receptor activity. Predicted to be involved in regulation of receptor recycling and response to lithium ion. Predicted to be located in membrane; parallel fiber to Purkinje cell synapse; and postsynaptic density. Predicted to be part of AMPA glutamate receptor complex. Predicted to be active in dendritic spine; glutamatergic synapse; and plasma membrane. Predicted to be integral component of postsynaptic density membrane and integral component of presynaptic membrane. Implicated in syndromic X-linked intellectual disability 94.

GO:

id name namespace
GO:0016020 membrane cellular_component

KEGG:

id description
K05199 GRIA3; glutamate receptor 3

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000032_00932336_00974922.mRNA True 486 mRNA 0.50 3 932336 974922

Neighbor

gene id symbol gene type direction distance location
CI01000032_00861012_00868904 FYN.L, FYNA, FYNB, FYN, FYN.S coding upstream 63432 860929 ~ 868904 (+)
CI01000032_00846052_00850360 COL10A1A coding upstream 81479 846052 ~ 850857 (+)
CI01000032_00811247_00821148 NA coding upstream 111102 811247 ~ 821234 (+)
CI01000032_00799216_00801849 FHL5 coding upstream 130367 798835 ~ 801969 (+)
CI01000032_00778485_00779572 FUT9A, FUT9 coding upstream 151570 778485 ~ 780766 (+)
CI01000032_01000707_01061531 GRIA3B, GRIA3 coding downstream 24256 999178 ~ 1061833 (+)
CI01000032_01179180_01182878 MAGT1 coding downstream 203329 1178251 ~ 1184021 (+)
CI01000032_01218926_01234833 PLS3 coding downstream 244004 1218926 ~ 1234929 (+)
CI01000032_01238397_01244212 NA coding downstream 263044 1237966 ~ 1244361 (+)
CI01000032_01251696_01259949 CNGA2, CNGA5 coding downstream 276425 1251347 ~ 1260248 (+)
G165512 NA non-coding upstream 58847 873220 ~ 873489 (+)
G165316 NA non-coding upstream 197198 733588 ~ 735138 (+)
G165317 NA non-coding upstream 222934 704041 ~ 709402 (+)
G165313 NA non-coding upstream 240846 690841 ~ 691490 (+)
G165299 NA non-coding upstream 285714 646335 ~ 646622 (+)
G165506 NA non-coding downstream 111002 1085924 ~ 1087253 (+)
G165505 NA non-coding downstream 124696 1099618 ~ 1102526 (+)
G165508 NA non-coding downstream 133491 1108413 ~ 1112892 (+)
G165564 NA non-coding downstream 226908 1201830 ~ 1202070 (+)
G165570 NA other downstream 374656 1349578 ~ 1357567 (+)
CI01000032_01698448_01701006 NA other downstream 723566 1698448 ~ 1701288 (+)
CI01000032_02773889_02774396 NA other downstream 1783810 2773889 ~ 2774501 (+)
G166734 NA other downstream 1860392 2835314 ~ 2849684 (+)
G166765 NA other downstream 1981866 2956788 ~ 2957213 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
bowfin (Amia calva) AMCG00021043 gria3,LOC104962462,LOC107733408 coding CM030130.1 CM030130.1 672030 ~ 674577 (+)