G165299


Basic Information

Item Value
gene id G165299
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000032
NCBI id null
chromosome length 4185905
location 646335 ~ 646622 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU187760
TGACTTTAATACTACATGATTTTTTATGTGCTTTCATAAACATCTCACAGTGTTGACAGAAAGCAGGGACTCAGCTGTGAAACCTTGCTATATTTTTAATTAAATTCTGCCTTCTGTCAGGACAGAGTAGTGATGTTGTTTTGTTTTTTTCACCGAGTTATTATCTTAGGACAGGCGATCAGGGGTACTGAGTGATAATGTAATGCAACATAACTAACAATAACCTTAACTGCATTTTAAAAAAATACAAAATATGTTTAGGCTACGTCTATACATACACATATTATT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU187760 True 288 lncRNA 0.33 1 646335 646622

Neighbor

gene id symbol gene type direction distance location
CI01000032_00541441_00550673 MAP7A coding upstream 95586 541441 ~ 550749 (+)
CI01000032_00503123_00508468 PNOCA coding upstream 137848 503123 ~ 508487 (+)
CI01000032_00388582_00397426 HMBOX1A, HMBOX1B, HMBOX1 coding upstream 248848 388367 ~ 397487 (+)
CI01000032_00367671_00375509 KCNK13, KCNK13A coding upstream 270535 366723 ~ 375800 (+)
CI01000032_00327020_00343184 NA coding upstream 303107 326645 ~ 343228 (+)
CI01000032_00716503_00725057 NA coding downstream 69881 716503 ~ 725436 (+)
CI01000032_00731152_00733159 GJA10, CX52.7 coding downstream 84196 730818 ~ 733454 (+)
CI01000032_00767450_00771237 MANEA coding downstream 120454 767076 ~ 771395 (+)
CI01000032_00778485_00779572 FUT9A, FUT9 coding downstream 131863 778485 ~ 780766 (+)
CI01000032_00799216_00801849 FHL5 coding downstream 152213 798835 ~ 801969 (+)
G165242 NA non-coding upstream 39586 606379 ~ 606749 (+)
G165236 NA non-coding upstream 40215 604364 ~ 606120 (+)
G165284 NA non-coding upstream 44649 600922 ~ 601686 (+)
G165253 NA non-coding upstream 46935 561194 ~ 599400 (+)
G165263 NA non-coding upstream 67911 578165 ~ 578424 (+)
G165313 NA non-coding downstream 44219 690841 ~ 691490 (+)
G165317 NA non-coding downstream 57419 704041 ~ 709402 (+)
G165316 NA non-coding downstream 86966 733588 ~ 735138 (+)
G165512 NA non-coding downstream 226598 873220 ~ 873489 (+)
CI01000032_01000707_01061531 GRIA3B, GRIA3 non-coding downstream 409253 999178 ~ 1061833 (+)
G165570 NA other downstream 702956 1349578 ~ 1357567 (+)
CI01000032_01698448_01701006 NA other downstream 1051866 1698448 ~ 1701288 (+)
CI01000032_02773889_02774396 NA other downstream 2112110 2773889 ~ 2774501 (+)
G166734 NA other downstream 2188692 2835314 ~ 2849684 (+)
G166765 NA other downstream 2310166 2956788 ~ 2957213 (+)

Expression


Co-expression Network