G186769


Basic Information

Item Value
gene id G186769
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000040
NCBI id null
chromosome length 6879596
location 5074850 ~ 5075049 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU212114
ATGGTAAACGTTGGTGGACAGCCATTTTTAGGTCTCTCCAGAGATGCTCAATTGAGTTTAAGTCAGGGCTCTGGCTGGGCCATTCAAGAACAGTCACGGAGTTGTTGTGAAGCCACTCCTTCGTTATTTTAGCTGTGTGCTTAGGGTCATTGTCTTGTTGGAAGGTAAACCTTCGGCCCAGTCTGAGGTCCTGAGCACTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU212114 True 200 lncRNA 0.49 1 5074850 5075049

Neighbor

gene id symbol gene type direction distance location
CI01000040_05047319_05069572 NA coding upstream 5165 5047171 ~ 5069685 (+)
CI01000040_05033284_05043565 NA coding upstream 31285 5033199 ~ 5043565 (+)
CI01000040_05011735_05014939 NA coding upstream 59525 5011735 ~ 5015325 (+)
CI01000040_04956324_04970782 CDC23.L, CDC23 coding upstream 103936 4956145 ~ 4970914 (+)
CI01000040_04938039_04944194 WDR55 coding upstream 130459 4935989 ~ 4944391 (+)
CI01000040_05088429_05089430 NA coding downstream 11200 5086249 ~ 5090404 (+)
CI01000040_05104703_05110165 KDELC2 coding downstream 29515 5104564 ~ 5111098 (+)
CI01000040_05211970_05223021 UBTD2 coding downstream 136921 5211970 ~ 5223621 (+)
CI01000040_05230946_05238111 NA coding downstream 155897 5230946 ~ 5238126 (+)
CI01000040_05264252_05286787 SYRC, RARS coding downstream 188667 5263716 ~ 5286870 (+)
G186762 NA non-coding upstream 4434 5070214 ~ 5070416 (+)
G186760 NA non-coding upstream 29265 5045050 ~ 5045585 (+)
G186696 NA non-coding upstream 58835 5015648 ~ 5016015 (+)
G186689 NA non-coding upstream 78571 4978626 ~ 4996279 (+)
G186741 NA non-coding upstream 97968 4976399 ~ 4976882 (+)
G186815 NA non-coding downstream 78461 5153510 ~ 5153808 (+)
G186785 NA non-coding downstream 107595 5182644 ~ 5186688 (+)
G186839 NA non-coding downstream 164885 5239934 ~ 5240457 (+)
G186842 NA non-coding downstream 167279 5242328 ~ 5242635 (+)
G186855 NA non-coding downstream 178984 5254033 ~ 5259349 (+)
G185947 NA other upstream 1100727 3973765 ~ 3974123 (+)
G185884 NA other upstream 1335569 3738987 ~ 3739281 (+)
G185296 NA other upstream 1740867 3333578 ~ 3333983 (+)
G184003 NA other upstream 3838361 1230292 ~ 1236489 (+)
CI01000040_00977184_00977458 NDUA2, NDUFA2 other upstream 4096687 977184 ~ 978163 (+)
G187510 NA other downstream 893996 5969045 ~ 5971732 (+)
G188149 NA other downstream 1733642 6808691 ~ 6809130 (+)
CI01000040_06833701_06848731 NA other downstream 1763075 6832987 ~ 6849135 (+)

Expression


Co-expression Network