G213308


Basic Information

Item Value
gene id G213308
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 525193 ~ 525394 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU241978
GCTACTTTTAGAATTCAATTAATAATTTAATTTGCCCCGCAATAATTTAGACGCGCTGTAATAAGATTAGCTAACTCCTCATTTTAAAAAAAACAACTTGTAACACCTACATCTCTTCTCATTTTTTTCAATACGTATGGGCCACAAGAGAAATATTAAGAAATAAATTAAGGTTAAATAGTGTTATCAGAACATGATGAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU241978 True 202 lncRNA 0.29 1 525193 525394

Neighbor

gene id symbol gene type direction distance location
CI01000050_00468156_00477480 CRELD1 coding downstream 47713 467368 ~ 477480 (-)
CI01000050_00362015_00370409 TMCC1 coding downstream 154784 360400 ~ 370409 (-)
CI01000050_00286164_00294317 NA coding downstream 230876 285258 ~ 294317 (-)
CI01000050_00278324_00281820 NA coding downstream 243373 278131 ~ 281820 (-)
CI01000050_00272347_00273047 NA coding downstream 251252 270941 ~ 273941 (-)
CI01000050_00552377_00552664 NA coding upstream 26095 551489 ~ 552861 (-)
CI01000050_00560254_00585128 BRPF1 coding upstream 34589 559983 ~ 586312 (-)
CI01000050_00662789_00668402 NINJ1 coding upstream 135682 661076 ~ 668402 (-)
CI01000050_00675537_00675797 NA coding upstream 149566 674960 ~ 676172 (-)
CI01000050_00786890_00789088 NA coding upstream 261240 786634 ~ 789088 (-)
G213299 NA non-coding downstream 86163 438827 ~ 439030 (-)
G213298 NA non-coding downstream 90396 434563 ~ 434797 (-)
G213297 NA non-coding downstream 90987 433707 ~ 434206 (-)
G213289 NA non-coding downstream 111605 413378 ~ 413588 (-)
G213265 NA non-coding downstream 227552 297237 ~ 297641 (-)
G213202 NA non-coding upstream 2062 527456 ~ 528142 (-)
G213317 NA non-coding upstream 3590 528984 ~ 529212 (-)
G213324 NA non-coding upstream 10170 535564 ~ 535885 (-)
G213326 NA non-coding upstream 11139 536533 ~ 537515 (-)
G213327 NA non-coding upstream 13499 538893 ~ 539174 (-)
G213174 NA other downstream 272131 235551 ~ 253062 (-)
G213171 NA other downstream 507212 16080 ~ 17981 (-)
G213429 NA other upstream 303948 829342 ~ 829802 (-)
G213497 NA other upstream 458084 983478 ~ 996539 (-)
G213704 NA other upstream 787589 1312983 ~ 1317106 (-)
CI01000050_02230904_02233429 NA other upstream 1707254 2228865 ~ 2233429 (-)
G213948 NA other upstream 1803119 2328513 ~ 2331316 (-)

Expression


Co-expression Network