RNA id: TCONS_00012519


Basic Information

Item Value
RNA id TCONS_00012519
length 543
RNA type processed_transcript
GC content 0.46
exon number 2
gene id XLOC_006449
representative True

Chromosome Information

Item Value
chromosome id NC_007124.7
NCBI id CM002897.2
chromosome length 52186027
location 9288383 ~ 9300299 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GGCACACATCGACGAGCGTATGTCAAGAGCATTCAGCCATATATTCCTTATTAAATAGGTTTACTATCATTATCTTCACTTAGACTTTAGGTAATGTATTCGACGCAGTGATGTGAAGTCCTGTTTCTATCGGGATTGAGTGTTTTCAACATCTGATGCAACATGGCAACCTCGCATGTTAATCGCTGTCTCCTAAGGACAATTACGAGATGTCATCGGGACAGCAGCCGGCAGCTGAACTTGACGACAGTAAGGGCATTAGGACACTTTTCTAACTTTTCTTCAGGTAAAGAGGAACACGTTGAAACTGTGGATCCACCGCGGGACTTTCTTTTCAGACACCCCTTTTCTGGTCGTGAGGTACCCATCTCGAATGGCTCTGGCTTTATAGTAAGTAGTGATGGCCTGATAGTGACAAATGCCCATGTGGTCGCCAACAAGCGTGGTGTTCGTGTCAAACTGACCAATGGTGAGACTTACAACGCCACAGTTCAGGATGTGGACCAGGCTGCAGACATCGCCACCATCAAAATCAATGTTAAG

Function

GO: NA

KEGG:

id description
ko04210 Apoptosis
ko04214 Apoptosis - fly
ko04215 Apoptosis - multiple species
ko05012 Parkinson disease
ko05022 Pathways of neurodegeneration - multiple diseases
ko01002 Peptidases and inhibitors
ko03110 Chaperones and folding catalysts

Ensembl:

ensembl_id ENSDART00000144714

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00012516 lncRNA downstream 4000 9288840 ~ 9291685 (-) False XLOC_006449
TCONS_00012518 lncRNA downstream 4117 9288840 ~ 9291568 (-) False XLOC_006449
TCONS_00013463 lncRNA downstream 279459 9009035 ~ 9016226 (-) False XLOC_006442
TCONS_00013751 lncRNA downstream 289088 9002682 ~ 9006597 (-) False XLOC_006442
TCONS_00012466 lncRNA downstream 513193 8781540 ~ 8782492 (-) True XLOC_006438
TCONS_00012524 lncRNA upstream 55848 9356089 ~ 9362323 (-) False XLOC_006453
TCONS_00013752 lncRNA upstream 55848 9356089 ~ 9367689 (-) False XLOC_006453
TCONS_00012527 lncRNA upstream 61747 9361988 ~ 9367041 (-) False XLOC_006453
TCONS_00013753 lncRNA upstream 201526 9501767 ~ 9558425 (-) True XLOC_006458
TCONS_00012542 lncRNA upstream 578305 9878546 ~ 9886518 (-) False XLOC_006465
TCONS_00012515 mRNA downstream 4186 9288822 ~ 9291499 (-) False XLOC_006449
TCONS_00012513 mRNA downstream 11275 9261815 ~ 9284410 (-) True XLOC_006448
TCONS_00012512 mRNA downstream 11278 9261815 ~ 9284407 (-) False XLOC_006448
TCONS_00012511 mRNA downstream 11278 9261815 ~ 9284407 (-) False XLOC_006448
TCONS_00012510 mRNA downstream 37954 9240925 ~ 9257731 (-) True XLOC_006447
TCONS_00012520 mRNA upstream 3313 9303554 ~ 9311253 (-) True XLOC_006450
TCONS_00012521 mRNA upstream 13536 9313777 ~ 9318891 (-) True XLOC_006451
TCONS_00012522 mRNA upstream 33076 9333317 ~ 9335891 (-) True XLOC_006452
TCONS_00012523 mRNA upstream 39678 9339919 ~ 9367647 (-) False XLOC_006453
TCONS_00012526 mRNA upstream 61591 9361832 ~ 9367675 (-) False XLOC_006453
TCONS_00012477 other downstream 286444 9003127 ~ 9009241 (-) False XLOC_006442
TCONS_00012459 other downstream 640238 8655119 ~ 8655447 (-) True XLOC_006435
TCONS_00012458 other downstream 645634 8649711 ~ 8650051 (-) True XLOC_006434
TCONS_00012435 other downstream 2975527 6288544 ~ 6320158 (-) False XLOC_006416
TCONS_00012432 other downstream 3043171 6247987 ~ 6252514 (-) True XLOC_006414
TCONS_00012525 other upstream 61569 9361810 ~ 9367689 (-) False XLOC_006453
TCONS_00012528 other upstream 61985 9362226 ~ 9368535 (-) True XLOC_006453
TCONS_00012530 other upstream 140087 9440328 ~ 9442332 (-) True XLOC_006454
TCONS_00012547 other upstream 779786 10080027 ~ 10114880 (-) False XLOC_006467
TCONS_00012548 other upstream 797610 10097851 ~ 10118935 (-) False XLOC_006467

Expression Profile

//