RNA id: TCONS_00013013


Basic Information

Item Value
RNA id TCONS_00013013
length 495
lncRNA type retained_intron
GC content 0.49
exon number 5
gene id XLOC_006759
representative False

Chromosome Information

Item Value
chromosome id NC_007124.7
NCBI id CM002897.2
chromosome length 52186027
location 33611703 ~ 33639050 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GAGATGATGGGTAAGCTACAGGCAGCCCAGGAGAGTCAATGCACATTACAGTCTGAGTGTGAACAGTACAGGATCGTTCTGGCGGAAACGGAGGGGATGCTGAAAACACTTCAGAAGAGTGTAGAGGAGGAGGAGAGTGTGTGGAGGACAAAGATTTCAGAATCTGAGGACAAACTGAGGATGGCACTCAAAAAAGTGCAAGAATTAGAAGAGACTGCAGAGCGCTTGAGAGCAGAGAGCCAAGGCAACCAACAGCTGCAGGAGCAAGTGAAGCTGCTGGAGGCTCAGTTGGAGGAACAGCTGCAGTCAGCTTCCACTGACAGTCAGAGTCAATCTGAAGAGATGGCACACTTGAAGCAGGCTTTAGCTGATACAGAAAGCCAGTTGAATTCGGCCCAGAAGGAGGCACAGACACAGAGAGAGGAACTTTTACAGGTTAGTTGGTTTTACTCAGAGGCCAGTGCAATTGTGTTTATCCATAATCCTGTGCAGAAG

Function

GO:

id name namespace
GO:0015031 protein transport biological_process
GO:0030176 integral component of endoplasmic reticulum membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-9795 Predicted to act upstream of or within protein transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be integral component of endoplasmic reticulum membrane. Is expressed in several structures, including anterior axial hypoblast; axial mesoderm; axis; cardiovascular system; and hatching gland. Orthologous to human RRBP1 (ribosome binding protein 1).

Ensembl:

ensembl_id ENSDART00000139153

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00013865 lncRNA downstream 153367 33452438 ~ 33463644 (-) True XLOC_006757
TCONS_00013866 lncRNA downstream 157693 33457523 ~ 33459318 (-) True XLOC_006758
TCONS_00013002 lncRNA downstream 315841 33264663 ~ 33301170 (-) True XLOC_006752
TCONS_00013864 lncRNA downstream 349411 33261131 ~ 33267600 (-) False XLOC_006752
TCONS_00013001 lncRNA downstream 349426 33261131 ~ 33267585 (-) False XLOC_006752
TCONS_00013014 lncRNA upstream 1348 33621270 ~ 33622673 (-) True XLOC_006759
TCONS_00013018 lncRNA upstream 39786 33659708 ~ 33662432 (-) True XLOC_006761
TCONS_00013024 lncRNA upstream 62674 33682596 ~ 33683869 (-) True XLOC_006764
TCONS_00013867 lncRNA upstream 1585375 35205297 ~ 35289099 (-) False XLOC_006774
TCONS_00013868 lncRNA upstream 1585375 35205297 ~ 35289375 (-) False XLOC_006774
TCONS_00013010 mRNA downstream 218276 33394116 ~ 33398735 (-) True XLOC_006756
TCONS_00013009 mRNA downstream 254820 33342455 ~ 33362191 (-) True XLOC_006755
TCONS_00013008 mRNA downstream 295470 33320604 ~ 33321541 (-) True XLOC_006754
TCONS_00013007 mRNA downstream 295953 33320063 ~ 33321058 (-) False XLOC_006754
TCONS_00013006 mRNA downstream 299685 33314847 ~ 33317326 (-) True XLOC_006753
TCONS_00013015 mRNA upstream 25491 33645413 ~ 33654931 (-) True XLOC_006760
TCONS_00013016 mRNA upstream 38949 33658871 ~ 33662523 (-) False XLOC_006761
TCONS_00013019 mRNA upstream 45383 33665305 ~ 33667922 (-) True XLOC_006762
TCONS_00013020 mRNA upstream 50014 33669936 ~ 33671694 (-) False XLOC_006763
TCONS_00013021 mRNA upstream 50020 33669942 ~ 33671694 (-) True XLOC_006763
TCONS_00012961 other downstream 1021791 32588552 ~ 32595220 (-) False XLOC_006734
TCONS_00012947 other downstream 1921964 31694931 ~ 31695047 (-) True XLOC_006722
TCONS_00012944 other downstream 1970005 31636732 ~ 31647006 (-) False XLOC_006720
TCONS_00012942 other downstream 2037447 31579448 ~ 31579564 (-) True XLOC_006718
TCONS_00012938 other downstream 2176071 31424590 ~ 31440940 (-) False XLOC_006716
TCONS_00013017 other upstream 39786 33659708 ~ 33662353 (-) False XLOC_006761
TCONS_00013028 other upstream 1018707 34638629 ~ 34638746 (-) True XLOC_006768
TCONS_00013029 other upstream 1024228 34644150 ~ 34644281 (-) True XLOC_006769
TCONS_00013036 other upstream 1563072 35182994 ~ 35194759 (-) True XLOC_006773
TCONS_00013037 other upstream 1586913 35206835 ~ 35221613 (-) False XLOC_006774

Expression Profile

//