RNA id: TCONS_00028975


Basic Information

Item Value
RNA id TCONS_00028975
length 221
RNA type mRNA
GC content 0.38
exon number 3
gene id XLOC_014667
representative False

Chromosome Information

Item Value
chromosome id NC_007130.7
NCBI id CM002903.2
chromosome length 48449771
location 17205143 ~ 17210928 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GTACAGCAATTATGGCAGCTATGAATGAGAAGTTCAAAGAAAAGGACAAGAAGATAGAAGAGGTTCGAAAGAACAAAGAAACCAAAGAGCACAATGCATTCTCTTTTTCAGATACATTCATAACTTCTGGACTTGGTGGGGACTTGTGTGCTTAACATGCCTGTTACTGTCTGCATTTCTTGAGCTTTTTGCTTTAAGGTTAAGAGCTTGGTTATGTACTT

Function

GO:

id name namespace
GO:0051493 regulation of cytoskeleton organization biological_process
GO:0007019 microtubule depolymerization biological_process
GO:0031110 regulation of microtubule polymerization or depolymerization biological_process
GO:0031175 neuron projection development biological_process
GO:0043005 neuron projection cellular_component
GO:0005737 cytoplasm cellular_component
GO:0015631 tubulin binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-031006-14 Predicted to enable tubulin binding activity. Predicted to be involved in microtubule depolymerization; neuron projection development; and regulation of microtubule polymerization or depolymerization. Predicted to be active in cytoplasm and neuron projection. Is expressed in several structures, including digestive system; nervous system; pectoral fin bud; tail bud; and ventral mesoderm. Orthologous to human STMN1 (stathmin 1).

Ensembl:

ensembl_id ENSDART00000151228

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00029770 lncRNA downstream 7161 17200675 ~ 17201052 (-) True XLOC_014666
TCONS_00029769 lncRNA downstream 94610 17109593 ~ 17113603 (-) True XLOC_014665
TCONS_00029768 lncRNA downstream 442396 16759374 ~ 16765817 (-) True XLOC_014663
TCONS_00028971 lncRNA downstream 774170 16431966 ~ 16434043 (-) True XLOC_014662
TCONS_00028970 lncRNA downstream 774329 16431966 ~ 16433884 (-) False XLOC_014662
TCONS_00029771 lncRNA upstream 15918 17224646 ~ 17231020 (-) True XLOC_014668
TCONS_00030189 lncRNA upstream 66730 17275458 ~ 17277807 (-) True XLOC_014669
TCONS_00030190 lncRNA upstream 112814 17321542 ~ 17321880 (-) True XLOC_014671
TCONS_00030191 lncRNA upstream 113272 17322000 ~ 17329053 (-) True XLOC_014672
TCONS_00030192 lncRNA upstream 144916 17353644 ~ 17354733 (-) True XLOC_014673
TCONS_00028961 mRNA downstream 1352786 15851226 ~ 15855427 (-) True XLOC_014656
TCONS_00028960 mRNA downstream 1773400 15423057 ~ 15434813 (-) True XLOC_014655
TCONS_00028958 mRNA downstream 1787495 15408363 ~ 15420718 (-) False XLOC_014654
TCONS_00028959 mRNA downstream 1787535 15417372 ~ 15420678 (-) True XLOC_014654
TCONS_00028957 mRNA downstream 1872426 15307902 ~ 15335787 (-) True XLOC_014653
TCONS_00028977 mRNA upstream 79801 17288529 ~ 17304866 (-) False XLOC_014670
TCONS_00028978 mRNA upstream 83786 17292514 ~ 17303500 (-) False XLOC_014670
TCONS_00028980 mRNA upstream 83919 17292647 ~ 17304995 (-) False XLOC_014670
TCONS_00028979 mRNA upstream 83919 17292647 ~ 17304995 (-) True XLOC_014670
TCONS_00028981 mRNA upstream 168618 17377346 ~ 17385548 (-) True XLOC_014674
TCONS_00028972 other downstream 208471 16999627 ~ 16999742 (-) True XLOC_014664
TCONS_00028964 other downstream 1178770 16029308 ~ 16029443 (-) True XLOC_014660
TCONS_00028963 other downstream 1179623 16028456 ~ 16028590 (-) True XLOC_014659
TCONS_00028962 other downstream 1180723 16027419 ~ 16027490 (-) True XLOC_014658
TCONS_00028954 other downstream 2015567 15174843 ~ 15192646 (-) True XLOC_014651
TCONS_00028989 other upstream 309333 17518061 ~ 17658173 (-) False XLOC_014675
TCONS_00028991 other upstream 310005 17518733 ~ 17526735 (-) True XLOC_014675
TCONS_00029018 other upstream 1208453 18417181 ~ 18418763 (-) False XLOC_014685
TCONS_00029036 other upstream 1625999 18834727 ~ 18834857 (-) True XLOC_014693
TCONS_00029037 other upstream 1629683 18838411 ~ 18838541 (-) True XLOC_014694