RNA id: TCONS_00029653


Basic Information

Item Value
RNA id TCONS_00029653
length 557
lncRNA type retained_intron
GC content 0.48
exon number 2
gene id XLOC_015059
representative False

Chromosome Information

Item Value
chromosome id NC_007130.7
NCBI id CM002903.2
chromosome length 48449771
location 47549568 ~ 47555956 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTTCCAGCCCTCTTTCATTGGTAAGTTTTGGTTTGGCCTGGTCAGATCACCTTGCGTTGCTGTTCTTACATCTCAAGAGCTTGTGAAATGTGCTAACACAGTGTGGGACGTTGTACCTCACAGGTATGGAGTCCGCTGGCATCCATGAAACTGCCTACAACAGTATTATGAAGTGCGACATTGATATCCGCAAGGATCTGTATGCCAACAACGTCCTTTCTGGTGGTACCACTATGTATCCAGGTATCGCTGACCGCATGCAGAAGGAAATCACTGCTCTGGCCCCCAGCACAATGAAGATCAAGATCATTGCTCCCCCTGAACGCAAGTACTCCGTCTGGATTGGTGGCTCCATCCTGGCCTCCCTGTCCACCTTCCAGCAGATGTGGATCAGCAAACAGGAGTATGATGAGGCAGGTCCCTCCATCGTCCACAGAAAGTGCTTCTAAATCTTCAATCCTTCTCTGTTCAGTCCAACTAACCCCCCGTATGCCTTTGTACTGTGCCTTGTGCTGTATATACATGTACCGTTGTAATAAAAGTTCTGATGTGTCCAT

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0036302 atrioventricular canal development biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:0032925 regulation of activin receptor signaling pathway biological_process
GO:0032926 negative regulation of activin receptor signaling pathway biological_process
GO:0007275 multicellular organism development biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0003203 endocardial cushion morphogenesis biological_process
GO:0048856 anatomical structure development biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0007389 pattern specification process biological_process
GO:0003272 endocardial cushion formation biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032502 developmental process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0005856 cytoskeleton cellular_component
GO:0005869 dynactin complex cellular_component
GO:0015629 actin cytoskeleton cellular_component
GO:0005737 cytoplasm cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0005524 ATP binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0000166 nucleotide binding molecular_function
GO:0000987 cis-regulatory region sequence-specific DNA binding molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040520-4 Acts upstream of or within atrioventricular canal development and endocardial cushion formation. Predicted to be part of dynactin complex. Is expressed in adaxial cell; brain; muscle; pericardial region; and trunk. Human ortholog(s) of this gene implicated in atrial heart septal defect 5; dilated cardiomyopathy; dilated cardiomyopathy 1R; and hypertrophic cardiomyopathy 11. Orthologous to human ACTC1 (actin alpha cardiac muscle 1).

Ensembl:

ensembl_id ENSDART00000158152

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00030351 lncRNA downstream 376160 47145193 ~ 47173408 (-) True XLOC_015051
TCONS_00030350 lncRNA downstream 376197 46999261 ~ 47173371 (-) False XLOC_015051
TCONS_00029639 lncRNA downstream 376470 47123688 ~ 47173098 (-) False XLOC_015051
TCONS_00030348 lncRNA downstream 785207 46724859 ~ 46764361 (-) False XLOC_015048
TCONS_00030349 lncRNA downstream 785600 46737118 ~ 46763968 (-) True XLOC_015048
TCONS_00030352 lncRNA upstream 210549 47760897 ~ 47761491 (-) True XLOC_015063
TCONS_00029800 lncRNA upstream 223569 47773917 ~ 47778637 (-) True XLOC_015064
TCONS_00030353 lncRNA upstream 381550 47931898 ~ 47932934 (-) True XLOC_015066
TCONS_00030354 lncRNA upstream 467358 48017706 ~ 48024071 (-) False XLOC_015069
TCONS_00030355 lncRNA upstream 634950 48185298 ~ 48186157 (-) True XLOC_015071
TCONS_00029650 mRNA downstream 22376 47524022 ~ 47527192 (-) False XLOC_015058
TCONS_00029651 mRNA downstream 22473 47524035 ~ 47527095 (-) False XLOC_015058
TCONS_00029652 mRNA downstream 22475 47526213 ~ 47527093 (-) True XLOC_015058
TCONS_00029649 mRNA downstream 22831 47523730 ~ 47526737 (-) False XLOC_015058
TCONS_00029648 mRNA downstream 25775 47522007 ~ 47523793 (-) False XLOC_015058
TCONS_00029655 mRNA upstream 14542 47564890 ~ 47570672 (-) False XLOC_015060
TCONS_00029657 mRNA upstream 15268 47565616 ~ 47571456 (-) False XLOC_015060
TCONS_00029656 mRNA upstream 15268 47565616 ~ 47571456 (-) False XLOC_015060
TCONS_00029658 mRNA upstream 17207 47567555 ~ 47571797 (-) False XLOC_015060
TCONS_00029660 mRNA upstream 17621 47567969 ~ 47571808 (-) True XLOC_015060
TCONS_00029643 other downstream 133163 47415590 ~ 47416405 (-) True XLOC_015055
TCONS_00029642 other downstream 149261 47400189 ~ 47400307 (-) True XLOC_015054
TCONS_00029625 other downstream 1526689 46019877 ~ 46022879 (-) False XLOC_015042
TCONS_00029620 other downstream 1589385 45955079 ~ 45960183 (-) True XLOC_015039
TCONS_00029605 other downstream 3487019 44049647 ~ 44062549 (-) False XLOC_015032
TCONS_00029659 other upstream 17365 47567713 ~ 47567848 (-) True XLOC_015061

Expression Profile

//