RNA id: TCONS_00044303


Basic Information

Item Value
RNA id TCONS_00044303
length 446
RNA type processed_transcript
GC content 0.52
exon number 4
gene id XLOC_022462
representative True

Chromosome Information

Item Value
chromosome id NC_007134.7
NCBI id CM002907.2
chromosome length 46223584
location 31276162 ~ 31346387 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGTGCGCCAGAGACTGAAAGCGGGGCGGGATGGAGGCGCTCTGCTCTATGTAATACAACCATAGTACGGGTAAAATACTGCTTTTTTACCTTAGTTTAATACACTTAAACTAAGCTTGTGGAGAAGGAAGCAACAGCGGAGACGTAGAGGATCTTAGGAAGGTCAAATTGTACAGGCACATTTCTCCAGATCACCTGTTGCAGGTGTGTGAGCGAGTGAGCCCACTTTTAGAGAGAGAAGTGCCAGCCAGCGTACCTGGAGTCAACTCACTTCTGGGAACCGGACGACAGTCAGTGCTGCGTACAAACAAAAGTTGTAAGCACGTGGTATGGAAGGGGTCGGCCCTCGCAGCTCTGCACTGTGGCAGGCCTCCCGAGCCGCCAGTCATCTTTGGGAGCCCGCCAAATATTGCGGAAACGATACACAGTCGGAGGCTGAATGGCTCT

Function

GO:

id name namespace
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0007010 cytoskeleton organization biological_process
GO:0008286 insulin receptor signaling pathway biological_process
GO:0008360 regulation of cell shape biological_process
GO:0005634 nucleus cellular_component
GO:0005158 insulin receptor binding molecular_function

KEGG:

id description
ko04121 Ubiquitin system

ZFIN:

id description
ZDB-GENE-050208-261 Predicted to enable insulin receptor binding activity. Predicted to be involved in cytoskeleton organization; regulation of cell shape; and regulation of transcription by RNA polymerase II. Predicted to act upstream of or within insulin receptor signaling pathway. Predicted to be active in nucleus. Orthologous to human PHIP (pleckstrin homology domain interacting protein).

Ensembl:

ensembl_id ENSDART00000131981

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00044302 lncRNA downstream 45271 31293552 ~ 31294182 (-) False XLOC_022462
TCONS_00044299 lncRNA downstream 72832 31253300 ~ 31266621 (-) True XLOC_022461
TCONS_00045032 lncRNA downstream 418442 30906424 ~ 30921011 (-) True XLOC_022458
TCONS_00045031 lncRNA downstream 1280277 30054434 ~ 30059176 (-) True XLOC_022451
TCONS_00045030 lncRNA downstream 1280327 30054434 ~ 30059126 (-) False XLOC_022451
TCONS_00045033 lncRNA upstream 56438 31401932 ~ 31403708 (-) True XLOC_022465
TCONS_00045034 lncRNA upstream 75317 31420811 ~ 31423522 (-) True XLOC_022466
TCONS_00044312 lncRNA upstream 82181 31427675 ~ 31428695 (-) True XLOC_022467
TCONS_00044325 lncRNA upstream 298838 31644332 ~ 31645735 (-) False XLOC_022471
TCONS_00045035 lncRNA upstream 661411 32006905 ~ 32007796 (-) True XLOC_022480
TCONS_00044297 mRNA downstream 279103 31041058 ~ 31060350 (-) False XLOC_022460
TCONS_00044298 mRNA downstream 279103 31046385 ~ 31060350 (-) True XLOC_022460
TCONS_00044296 mRNA downstream 378947 30937757 ~ 30960506 (-) True XLOC_022459
TCONS_00044295 mRNA downstream 384715 30937757 ~ 30954738 (-) False XLOC_022459
TCONS_00044288 mRNA downstream 551521 30767310 ~ 30787932 (-) False XLOC_022457
TCONS_00044304 mRNA upstream 12594 31358088 ~ 31372807 (-) False XLOC_022463
TCONS_00044305 mRNA upstream 12617 31358111 ~ 31372789 (-) False XLOC_022463
TCONS_00044306 mRNA upstream 17095 31362589 ~ 31372639 (-) True XLOC_022463
TCONS_00044307 mRNA upstream 35113 31380607 ~ 31400792 (-) False XLOC_022464
TCONS_00044308 mRNA upstream 35220 31380714 ~ 31396344 (-) True XLOC_022464
TCONS_00044285 other downstream 640766 30658642 ~ 30698687 (-) True XLOC_022453
TCONS_00044283 other downstream 640777 30517199 ~ 30698676 (-) False XLOC_022453
TCONS_00044284 other downstream 731352 30607983 ~ 30608101 (-) True XLOC_022454
TCONS_00044280 other downstream 1293800 30042489 ~ 30045653 (-) True XLOC_022450
TCONS_00044252 other downstream 1962612 29375678 ~ 29376841 (-) True XLOC_022434
TCONS_00044322 other upstream 295628 31641122 ~ 31648016 (-) False XLOC_022471
TCONS_00044327 other upstream 347874 31693368 ~ 31717710 (-) True XLOC_022472
TCONS_00044329 other upstream 409258 31754752 ~ 31754868 (-) True XLOC_022474
TCONS_00044334 other upstream 457588 31803082 ~ 31804360 (-) True XLOC_022475
TCONS_00044337 other upstream 561504 31906998 ~ 31913242 (-) False XLOC_022476

Expression Profile

//