RNA id: TCONS_00045290


Basic Information

Item Value
RNA id TCONS_00045290
length 554
RNA type mRNA
GC content 0.48
exon number 4
gene id XLOC_022773
representative True

Chromosome Information

Item Value
chromosome id NC_007135.7
NCBI id CM002908.2
chromosome length 42172926
location 7741521 ~ 7746478 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGTCTCTCATCAAGCAGAATCTGCACTCAAATAATGAGGCGAACATCAACAAGCTGATCAACCTGAAGCTGACGGCCTCTTATGTGTATCTCTCTCTGGGAATGTATTTTGATAGGGATGATGTGGCTCTACCCAACTTCTCCAAGTTTTTCCTGGAGCGTTCACATAAGGAGAGAGATCATGCGGAGGACCTGCTGGAGTATCAAAACACAAGAGGAGGACGAATCCTTCTTCAGACTGTTGCGAAGCCCAGTCGTGATGACTGGAAAGGAGGTATTGATGCGCTCGCTTTTTCTCTGGAACATCAAAAGTCTATTAACCGATCCTTGCTGGAGGTCCATCGAGTGGCAGGAGAGCACTCTGACCCTCATCTCTCTGACTTCCTAGAAGGTAAATTCTTCACTGACAGCCATGAAACCATCAAGACATTGGGTGACTACTTGGGCAGTCTGAGTCGCATCACGTCTTCGGACCCACACGGCAAGATGGCGGAGTATCTGTTTGACAAGCACACACTCTCATCCACTCAGATCTCATGAGTTTGCTGCAACAA

Function

GO:

id name namespace
GO:0006879 cellular iron ion homeostasis biological_process
GO:0006880 intracellular sequestering of iron ion biological_process
GO:0006826 iron ion transport biological_process
GO:0005737 cytoplasm cellular_component
GO:0005506 iron ion binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0008198 ferrous iron binding molecular_function
GO:0008199 ferric iron binding molecular_function
GO:0004322 ferroxidase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-1948 Predicted to enable ferric iron binding activity and ferrous iron binding activity. Predicted to be involved in intracellular sequestering of iron ion. Predicted to act upstream of or within cellular iron ion homeostasis and iron ion transport. Predicted to be active in cytoplasm.

Ensembl:

ensembl_id ENSDART00000189956

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00046791 lncRNA upstream 184551 7553299 ~ 7557890 (+) False XLOC_022770
TCONS_00046793 lncRNA upstream 184551 7554629 ~ 7557890 (+) False XLOC_022770
TCONS_00046792 lncRNA upstream 184551 7554629 ~ 7557890 (+) True XLOC_022770
TCONS_00046932 lncRNA upstream 1342656 6389435 ~ 6399785 (+) True XLOC_022764
TCONS_00046931 lncRNA upstream 1653188 6085433 ~ 6089253 (+) True XLOC_022761
TCONS_00046933 lncRNA downstream 496927 8243024 ~ 8245079 (+) True XLOC_022777
TCONS_00046934 lncRNA downstream 521486 8267583 ~ 8273614 (+) False XLOC_022778
TCONS_00046935 lncRNA downstream 521680 8267777 ~ 8273614 (+) False XLOC_022778
TCONS_00046936 lncRNA downstream 521691 8267788 ~ 8273614 (+) False XLOC_022778
TCONS_00046937 lncRNA downstream 521755 8267852 ~ 8295447 (+) True XLOC_022778
TCONS_00045287 mRNA upstream 27879 7708652 ~ 7714562 (+) True XLOC_022772
TCONS_00045286 mRNA upstream 74283 7637522 ~ 7668158 (+) True XLOC_022771
TCONS_00045284 mRNA upstream 74332 7631797 ~ 7668109 (+) False XLOC_022771
TCONS_00045285 mRNA upstream 103871 7637264 ~ 7638570 (+) False XLOC_022771
TCONS_00045283 mRNA upstream 194577 7536041 ~ 7547864 (+) True XLOC_022769
TCONS_00045291 mRNA downstream 36216 7782313 ~ 7811648 (+) False XLOC_022774
TCONS_00045292 mRNA downstream 54389 7800486 ~ 7816871 (+) True XLOC_022774
TCONS_00045293 mRNA downstream 82000 7828097 ~ 7854229 (+) False XLOC_022775
TCONS_00045294 mRNA downstream 82516 7828613 ~ 7853917 (+) True XLOC_022775
TCONS_00045295 mRNA downstream 115276 7861373 ~ 7935809 (+) False XLOC_022776
TCONS_00045274 other upstream 1160273 6582052 ~ 6582168 (+) True XLOC_022766
TCONS_00045273 other upstream 1337125 6405194 ~ 6405316 (+) True XLOC_022765
TCONS_00045270 other upstream 1678656 6063671 ~ 6063785 (+) True XLOC_022760
TCONS_00045239 other upstream 3586042 4154959 ~ 4156399 (+) True XLOC_022744
TCONS_00045238 other upstream 3682868 4059456 ~ 4059573 (+) True XLOC_022743
TCONS_00045322 other downstream 2000195 9746292 ~ 9866290 (+) True XLOC_022791
TCONS_00045329 other downstream 2491192 10237289 ~ 10270299 (+) True XLOC_022794
TCONS_00045332 other downstream 2557000 10303097 ~ 10319018 (+) False XLOC_022795
TCONS_00045341 other downstream 3071863 10817960 ~ 10818085 (+) True XLOC_022800
TCONS_00045351 other downstream 3818799 11564896 ~ 11566442 (+) True XLOC_022807

Expression Profile

//