RNA id: TCONS_00004984


Basic Information

Item Value
RNA id TCONS_00004984
length 796
RNA type mRNA
GC content 0.50
exon number 7
gene id XLOC_002681
representative False

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 17171604 ~ 17222083 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AACCTTTGTCTATGGCTTCTACTTCTACCGGATTGTCGATAAAGATAACGAGAAGGCCCCGCTGACTCAGCTTCCCCCAGCTGGAGCGAATGTATGGTCAGCTGCAGCTTTGGAAGACTTCGCTCTTTTCCAGAGGAAGTGGTTCGAGGTGGCCTTTGTTATGGAGGAACGTCGACCATGTGACTTACCTGCCTTTCTGCTGCCTTGGTTGCCCAGCCGGCCAGCCTCGTATGCAACCGCCACAGTTCCAGAGCAGAAAACAGTCACCTTGGATGTCGATGTGAACAATCGTAGTGATCGGACAGAATGGTGCAGCTGCTATTACCATGGCAACTTCTCCCTTAATGCTGCCTTTGAAATCAAGCTGCACTGGATGGCCGTCACTGCAGCCGTGCTCTTTGAAATGGTGCAAGGCTGGCACAGGAAGGCAGCATCTTGCGGATTCCTGCTTGTCCCTGTGTTGGAGGTGCCCTTTGCTTTGTCGTCATACCTATATGGCGACCCACTCCGTGCTCAGTTGTTTATTCCCCTAAATATCCAGTGCCTGCTAAAGGAGGGCTCTGATAACCTTTTTGAGGGTTTTGAGCCAGAGACATACTGGGACAGAATGCAATTGTTTCAGGAGGCCATACTGACTAGATTTGGCTTTGTTCAAGACAAGTTCTCAGCGTCAGCTTTTAACTTTCCATCAGAGAACAAACCTCAGTACATCCATGTAACAGGTACAGTATTTCTTCAGCTGCCTTACTCTAAAAGGAAGTACAGTAGTGGACAGAGGCGACGCCGTAACTCCACC

Function

GO:

id name namespace
GO:0034198 cellular response to amino acid starvation biological_process
GO:0035556 intracellular signal transduction biological_process
GO:0098908 regulation of neuronal action potential biological_process
GO:0010506 regulation of autophagy biological_process
GO:0032007 negative regulation of TOR signaling biological_process
GO:0036269 swimming behavior biological_process
GO:0005765 lysosomal membrane cellular_component
GO:1990130 GATOR1 complex cellular_component
GO:0005096 GTPase activator activity molecular_function

KEGG:

id description
ko04150 mTOR signaling pathway
ko04131 Membrane trafficking

ZFIN:

id description
ZDB-GENE-091204-356 Predicted to contribute to GTPase activator activity. Acts upstream of or within regulation of neuronal action potential and swimming behavior. Predicted to be part of GATOR1 complex. Predicted to be active in lysosomal membrane. Is expressed in central nervous system and notochord. Used to study focal epilepsy. Human ortholog(s) of this gene implicated in focal epilepsy. Orthologous to human DEPDC5 (DEP domain containing 5, GATOR1 subcomplex subunit).

Ensembl:

ensembl_id ENSDART00000131751

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00006021 lncRNA downstream 83053 17085524 ~ 17088911 (-) True XLOC_002676
TCONS_00004976 lncRNA downstream 88833 17077604 ~ 17083131 (-) True XLOC_002675
TCONS_00006020 lncRNA downstream 144853 17016799 ~ 17027111 (-) True XLOC_002674
TCONS_00006019 lncRNA downstream 152789 17016799 ~ 17019175 (-) False XLOC_002674
TCONS_00006018 lncRNA downstream 152794 17016799 ~ 17019170 (-) False XLOC_002674
TCONS_00006022 lncRNA upstream 258075 17437490 ~ 17440666 (-) False XLOC_002685
TCONS_00006023 lncRNA upstream 258075 17437490 ~ 17441982 (-) False XLOC_002685
TCONS_00006025 lncRNA upstream 258075 17437490 ~ 17442421 (-) False XLOC_002685
TCONS_00006024 lncRNA upstream 258075 17437490 ~ 17442421 (-) True XLOC_002685
TCONS_00004994 lncRNA upstream 281374 17460789 ~ 17463417 (-) False XLOC_002686
TCONS_00004981 mRNA downstream 1878 17166035 ~ 17170086 (-) True XLOC_002680
TCONS_00004979 mRNA downstream 12203 17135631 ~ 17159761 (-) False XLOC_002679
TCONS_00004977 mRNA downstream 68313 17102902 ~ 17103651 (-) True XLOC_002677
TCONS_00004974 mRNA downstream 88784 17077177 ~ 17083180 (-) False XLOC_002675
TCONS_00004973 mRNA downstream 303753 16857529 ~ 16868211 (-) True XLOC_002672
TCONS_00004987 mRNA upstream 597 17180012 ~ 17185814 (-) True XLOC_002681
TCONS_00004988 mRNA upstream 44266 17223681 ~ 17232372 (-) False XLOC_002682
TCONS_00004989 mRNA upstream 44570 17223985 ~ 17231917 (-) True XLOC_002682
TCONS_00004990 mRNA upstream 75087 17254502 ~ 17284055 (-) True XLOC_002683
TCONS_00004992 mRNA upstream 280943 17460358 ~ 17484762 (-) False XLOC_002686
TCONS_00004980 other downstream 15289 17145819 ~ 17156675 (-) True XLOC_002679
TCONS_00004978 other downstream 39054 17104298 ~ 17132910 (-) True XLOC_002678
TCONS_00004975 other downstream 88587 17077433 ~ 17083377 (-) False XLOC_002675
TCONS_00004954 other downstream 1552949 15618216 ~ 15619015 (-) False XLOC_002664
TCONS_00004948 other downstream 1831632 15337310 ~ 15340332 (-) False XLOC_002662
TCONS_00004991 other upstream 162950 17342365 ~ 17342481 (-) True XLOC_002684
TCONS_00004997 other upstream 314066 17493481 ~ 17501404 (-) True XLOC_002687
TCONS_00004998 other upstream 330565 17509980 ~ 17519034 (-) True XLOC_002688
TCONS_00004999 other upstream 354195 17533610 ~ 17543022 (-) True XLOC_002689
TCONS_00005003 other upstream 383560 17562975 ~ 17570152 (-) False XLOC_002691

Expression Profile

//