RNA id: TCONS_00005170


Basic Information

Item Value
RNA id TCONS_00005170
length 773
RNA type mRNA
GC content 0.46
exon number 5
gene id XLOC_002794
representative False

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 25694395 ~ 25716953 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TGGTCGATTCCGCTCACGTGCCTCCTCTTATCAAACACAGTCGGTTTCTTTCACTCTCTCACAACTTCTCAGTTTGCATAATCTACAGTCAGCATGGTGAACAAGGCCGTTTGTGTGCTTAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAATCAAGAGGGTGAAAAGAAGCCAGTCAAGGTGACTGGTGAAATTACTGGCCTTACTCCAGGAAAACATGGTTTCCACGTCCATGCTTTTGGTGACAACACAAACGGCTGCATCAGTGCAGGTCCGCACTTCAACCCTCATGACAAAACTCATGGTGGGCCAACCGATAGTGTGAGACACGTCGGAGACCTGGGTAATGTGACCGCTGATGCCAGTGGTGTTGCAAAAATTGAAATCGAGGATGCAATGCTGACTCTGTCAGGCCAACATTCTATTATTGGGAGGACCATGGTGATTCATGAGAAGGAGGATGACTTGGGGAAGGGTGGCAATGAGGAAAGTCTTAAAACTGGCAACGCTGGTGGTCGTCTGGCCTGTGGAGTGATCGGCATCACTCAGTGAATCTGCTCTAATGGAAGAGCCGGTTGAAATATTGGTGACCAATGTGGATGCCTCTGAAAGCACTTAGCCCGCTGACAATTACATCTCTATTTTTGTTAGGTAACGTTGAAAGAATTGTACTTTAGCCTTGTTAAGCTGTTTTTCTGTGCATTTCTATGTGGGCAACCTTTTATTTGTTATCTGCTTAATTCATTAAACATTGAGCAGACTGGAAA

Function

GO:

id name namespace
GO:0070050 neuron cellular homeostasis biological_process
GO:0009410 response to xenobiotic stimulus biological_process
GO:0055114 oxidation-reduction process biological_process
GO:0051597 response to methylmercury biological_process
GO:0006801 superoxide metabolic process biological_process
GO:0019430 removal of superoxide radicals biological_process
GO:0010038 response to metal ion biological_process
GO:0005777 peroxisome cellular_component
GO:0005829 cytosol cellular_component
GO:0005576 extracellular region cellular_component
GO:0005615 extracellular space cellular_component
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005739 mitochondrion cellular_component
GO:0004784 superoxide dismutase activity molecular_function
GO:0005507 copper ion binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0016491 oxidoreductase activity molecular_function
GO:0016209 antioxidant activity molecular_function

KEGG:

id description
ko04146 Peroxisome
ko04213 Longevity regulating pathway - multiple species
ko05208 Chemical carcinogenesis - reactive oxygen species
ko05012 Parkinson disease
ko05014 Amyotrophic lateral sclerosis
ko05016 Huntington disease
ko05020 Prion disease
ko05022 Pathways of neurodegeneration - multiple diseases

ZFIN:

id description
ZDB-GENE-990415-258 Enables superoxide dismutase activity. Acts upstream of or within several processes, including neuron cellular homeostasis; response to metal ion; and response to methylmercury. Predicted to be located in cytoplasm. Predicted to be active in several cellular components, including cytosol; mitochondrion; and peroxisome. Is expressed in several structures, including atrium; blastoderm; blastodisc; musculature system; and nervous system. Used to study amyotrophic lateral sclerosis. Human ortholog(s) of this gene implicated in several diseases, including Down syndrome; artery disease (multiple); eye disease (multiple); glucose metabolism disease (multiple); and neurodegenerative disease (multiple). Orthologous to human SOD1 (superoxide dismutase 1).

Ensembl:

ensembl_id ENSDART00000064376

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00005764 lncRNA downstream 2725 25690872 ~ 25691670 (-) True XLOC_002793
TCONS_00005763 lncRNA downstream 7177 25686901 ~ 25687218 (-) True XLOC_002792
TCONS_00005168 lncRNA downstream 118822 25574557 ~ 25575573 (-) False XLOC_002791
TCONS_00005165 lncRNA downstream 123766 25523688 ~ 25570629 (-) True XLOC_002789
TCONS_00006053 lncRNA downstream 198139 25494173 ~ 25496256 (-) False XLOC_002790
TCONS_00006054 lncRNA upstream 433015 26132469 ~ 26142597 (-) False XLOC_002799
TCONS_00005184 lncRNA upstream 441616 26141070 ~ 26142597 (-) True XLOC_002799
TCONS_00006055 lncRNA upstream 741598 26441052 ~ 26447113 (-) False XLOC_002802
TCONS_00006056 lncRNA upstream 741598 26441052 ~ 26447171 (-) True XLOC_002802
TCONS_00006057 lncRNA upstream 1137382 26836836 ~ 26872413 (-) True XLOC_002807
TCONS_00005166 mRNA downstream 36889 25572372 ~ 25657506 (-) False XLOC_002791
TCONS_00005167 mRNA downstream 65840 25572769 ~ 25628555 (-) False XLOC_002791
TCONS_00005169 mRNA downstream 103201 25581941 ~ 25591194 (-) True XLOC_002791
TCONS_00005163 mRNA downstream 123748 25464220 ~ 25570647 (-) False XLOC_002789
TCONS_00005160 mRNA downstream 132644 25403023 ~ 25561751 (-) False XLOC_002789
TCONS_00005173 mRNA upstream 1257 25700711 ~ 25716841 (-) False XLOC_002794
TCONS_00005174 mRNA upstream 1904 25701358 ~ 25716953 (-) True XLOC_002794
TCONS_00005175 mRNA upstream 62742 25762196 ~ 25769334 (-) True XLOC_002795
TCONS_00005176 mRNA upstream 71013 25770467 ~ 25816558 (-) False XLOC_002796
TCONS_00005177 mRNA upstream 71577 25771031 ~ 25817854 (-) True XLOC_002796
TCONS_00005164 other downstream 194921 25494173 ~ 25499474 (-) True XLOC_002790
TCONS_00005133 other downstream 1238663 24455616 ~ 24455732 (-) True XLOC_002771
TCONS_00005130 other downstream 1311014 24383266 ~ 24383381 (-) True XLOC_002768
TCONS_00005129 other downstream 1314619 24377417 ~ 24379776 (-) True XLOC_002767
TCONS_00005104 other downstream 2862966 22828366 ~ 22831429 (-) True XLOC_002753
TCONS_00005183 other upstream 433015 26132469 ~ 26141081 (-) False XLOC_002799
TCONS_00005187 other upstream 496830 26196284 ~ 26202523 (-) False XLOC_002800
TCONS_00005203 other upstream 1044142 26743596 ~ 26744131 (-) True XLOC_002804
TCONS_00005214 other upstream 1306817 27006271 ~ 27009124 (-) False XLOC_002814
TCONS_00005218 other upstream 1470502 27169956 ~ 27170072 (-) True XLOC_002817

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000304_11845828_11848857.mRNA True 985 mRNA 0.44 5 CI01000304 11845614 ~ 11849163 (-)
striped catfish (Pangasianodon hypophthalmus) TU316367 True 708 lncRNA 0.43 4 NC_047611.1 10885561 ~ 10890549 (-)