RNA id: TCONS_00067949


Basic Information

Item Value
RNA id TCONS_00067949
length 805
RNA type nonsense_mediated_decay
GC content 0.51
exon number 8
gene id XLOC_034940
representative False

Chromosome Information

Item Value
chromosome id NC_007118.7
NCBI id CM002891.2
chromosome length 74282399
location 38635538 ~ 38638809 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GTCTTTGGACACCATGGTTGCAATGAAGGTGACTTTCGGCCTGTTGGCCCTGATGCTGGTCTCCTCTGTTAGAGCTGAGGAGATGCTGCTGTGGATGAGTCTGCTGAGCTGTCTGTGTCTGAACTGCTGCATAGAGCCAACAGAGGCATCATTCCTGAAGCTGATGAGCCCAAGCTTCTGGATGACATTGCTGTGAATGAGAGAAACGCTGATCCCTGCACCTCTTACAGCTGTCTCTGGCCCAAATACAGTGACGGCAAGATTTATGTGCCTTACGTCATCGCCAACCACTACTCCTCCCGTGAGCTGGAGATCATCCAGCGCGGTCTGGACTCTTTTGCTTCTGTCTCTTGTATCCGCTTCTTCCGCCGCAGCAATGAAAGAGACTACATCAGCATTGAGTCTCGCAGCGGGTGCTACTCTTACGTTGGCCGTCAGGGTAATGTCCAGACAGTATCTCTGGCCCGAAGTGGCTGTCTTTACCACAGCACTGTTCAGCATGAGCTGCTCCACGCCCTGGGCTTCAACCATGAACAAACCCGCAGTGACCGTGACAATCACATCCAGGTCATCTGGGAGAACATCCTTGATGACATGAAGTACAACTTCAATAAAATCAACACCCTGAACCAGGGAACTCCTTATGACTACAAGTCTGTGATGCAGTACGAGAGGTATGCTTTCTCCAAGAACGGATATCCCACTATGATTCCCATTCCCAACAATAACGCTGAGCTGGGCAAGTCCACTCAGATGAGCCAGAATGACATCACCAGGCTTAACAGACTCTACCAGTGCTGAGCAG

Function

GO:

id name namespace
GO:0006508 proteolysis biological_process
GO:0046872 metal ion binding molecular_function
GO:0004222 metalloendopeptidase activity molecular_function
GO:0016787 hydrolase activity molecular_function
GO:0008233 peptidase activity molecular_function
GO:0008237 metallopeptidase activity molecular_function
GO:0008270 zinc ion binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050626-100 Predicted to enable metalloendopeptidase activity. Predicted to act upstream of or within proteolysis.

Ensembl:

ensembl_id ENSDART00000173943

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00067944 lncRNA downstream 58388 38574923 ~ 38577255 (-) True XLOC_034938
TCONS_00067936 lncRNA downstream 58439 38573931 ~ 38577204 (-) False XLOC_034938
TCONS_00067942 lncRNA downstream 58486 38574765 ~ 38577157 (-) False XLOC_034938
TCONS_00067941 lncRNA downstream 58486 38574765 ~ 38577157 (-) False XLOC_034938
TCONS_00067938 lncRNA downstream 58496 38574663 ~ 38577147 (-) False XLOC_034938
TCONS_00067955 lncRNA upstream 11299 38649588 ~ 38651305 (-) True XLOC_034942
TCONS_00067957 lncRNA upstream 15504 38653793 ~ 38657203 (-) False XLOC_034943
TCONS_00067967 lncRNA upstream 65311 38703600 ~ 38714562 (-) True XLOC_034947
TCONS_00067968 lncRNA upstream 118037 38756326 ~ 38767909 (-) True XLOC_034948
TCONS_00067978 lncRNA upstream 192095 38830384 ~ 38835906 (-) False XLOC_034951
TCONS_00067946 mRNA downstream 798 38600150 ~ 38634845 (-) False XLOC_034939
TCONS_00067945 mRNA downstream 1776 38600150 ~ 38633867 (-) False XLOC_034939
TCONS_00067947 mRNA downstream 23413 38601949 ~ 38612230 (-) True XLOC_034939
TCONS_00067931 mRNA downstream 64703 38536978 ~ 38570940 (-) False XLOC_034936
TCONS_00067930 mRNA downstream 64708 38535934 ~ 38570935 (-) False XLOC_034936
TCONS_00067952 mRNA upstream 3825 38642114 ~ 38644560 (-) False XLOC_034941
TCONS_00067954 mRNA upstream 4167 38642456 ~ 38644287 (-) True XLOC_034941
TCONS_00067956 mRNA upstream 15192 38653481 ~ 38658430 (-) False XLOC_034943
TCONS_00067958 mRNA upstream 16800 38655089 ~ 38658411 (-) False XLOC_034943
TCONS_00067959 mRNA upstream 16878 38655167 ~ 38659477 (-) True XLOC_034943
TCONS_00067914 other downstream 941691 37693838 ~ 37693952 (-) True XLOC_034923
TCONS_00067911 other downstream 1071678 37560080 ~ 37563965 (-) True XLOC_034921
TCONS_00067904 other downstream 1959769 36671337 ~ 36675874 (-) False XLOC_034917
TCONS_00067876 other downstream 3657174 34978351 ~ 34978469 (-) True XLOC_034894
TCONS_00067875 other downstream 3791921 34827626 ~ 34843722 (-) True XLOC_034893
TCONS_00067953 other upstream 3830 38642119 ~ 38644287 (-) False XLOC_034941
TCONS_00067973 other upstream 165834 38804123 ~ 38807825 (-) False XLOC_034950
TCONS_00067981 other upstream 498361 39136650 ~ 39136774 (-) True XLOC_034953
TCONS_00067983 other upstream 596706 39234995 ~ 39235112 (-) True XLOC_034955
TCONS_00067999 other upstream 1077423 39715712 ~ 39716073 (-) True XLOC_034962