RNA id: TCONS_00070908


Basic Information

Item Value
RNA id TCONS_00070908
length 506
RNA type mRNA
GC content 0.46
exon number 5
gene id XLOC_036278
representative True

Chromosome Information

Item Value
chromosome id NC_007119.7
NCBI id CM002892.2
chromosome length 54304671
location 13794785 ~ 13823098 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ACTTTCTACAGTCAATCTACACCTTCTCTCAGAGGAGCGTCAATTGATTTTAAAACATCGACTCAAGTGGTTTTTGGACGCTTTCATCTCCTCGTTGTGAAGTATGTCTCAGAGGAGTAGAACGTCTTCAAAAGAAAGCAGCTCTGGTCCTTCATCTTCATCAGACACTCCTCCTCCACGCTCCGCGCTCCGCAACTCCTCCAAAGACTCAAAAAACTCTGGCCACAGGGGCTCATCTGACAGCCAAGGACGCCGCGGAAGCAGAACATTCAGCCAGAACTCAGCTATTGCTGCAGCGTATACGCAGTATCTCAATTCTCTATTTGGACAGGACAGAGATTTACTGCCAGAGGAACTGGATGAGCTGCTTGAAGCGTTTAAAGAGTTCGACTATGACCAGGACGGGTATTTGCACTACAAAGATGTGGCAGACTGCATGAGAACTATGGGATACATGCCAACAGAGATGGAACTGATTGAGATCATTCAGCAGATAAAAATGAAAT

Function

GO:

id name namespace
GO:0007601 visual perception biological_process
GO:0007165 signal transduction biological_process
GO:0005509 calcium ion binding molecular_function
GO:0005246 calcium channel regulator activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-081104-291 Predicted to enable calcium ion binding activity. Is expressed in retinal photoreceptor layer. Orthologous to human CABP4 (calcium binding protein 4).

Ensembl:

ensembl_id ENSDART00000137021

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00072011 lncRNA downstream 85650 13714942 ~ 13716577 (-) True XLOC_036277
TCONS_00070904 lncRNA downstream 123812 13666427 ~ 13678415 (-) False XLOC_036276
TCONS_00072406 lncRNA downstream 496179 13302679 ~ 13306048 (-) True XLOC_036263
TCONS_00072405 lncRNA downstream 954741 12845269 ~ 12847486 (-) True XLOC_036254
TCONS_00072404 lncRNA downstream 1092003 12686691 ~ 12710224 (-) True XLOC_036253
TCONS_00070911 lncRNA upstream 147792 13970890 ~ 13972558 (-) True XLOC_036280
TCONS_00070916 lncRNA upstream 206823 14029921 ~ 14043884 (-) False XLOC_036283
TCONS_00070929 lncRNA upstream 348978 14172076 ~ 14179774 (-) False XLOC_036290
TCONS_00070937 lncRNA upstream 615692 14438790 ~ 14452438 (-) True XLOC_036294
TCONS_00072012 lncRNA upstream 651671 14474769 ~ 14482295 (-) False XLOC_036296
TCONS_00070906 mRNA downstream 66655 13722656 ~ 13735572 (-) True XLOC_036275
TCONS_00070902 mRNA downstream 79545 13643799 ~ 13722682 (-) False XLOC_036275
TCONS_00070903 mRNA downstream 123812 13653699 ~ 13678415 (-) False XLOC_036276
TCONS_00070905 mRNA downstream 123812 13672285 ~ 13678415 (-) True XLOC_036276
TCONS_00070901 mRNA downstream 161205 13630492 ~ 13641022 (-) True XLOC_036274
TCONS_00070910 mRNA upstream 137557 13960655 ~ 13972626 (-) False XLOC_036280
TCONS_00070912 mRNA upstream 155388 13978486 ~ 13985032 (-) True XLOC_036281
TCONS_00070913 mRNA upstream 168199 13991297 ~ 13999293 (-) True XLOC_036282
TCONS_00070914 mRNA upstream 180134 14003232 ~ 14052349 (-) False XLOC_036283
TCONS_00070915 mRNA upstream 183614 14006712 ~ 14049404 (-) False XLOC_036283
TCONS_00070885 other downstream 563135 13238973 ~ 13239092 (-) True XLOC_036261
TCONS_00070876 other downstream 789400 12998252 ~ 13012827 (-) False XLOC_036256
TCONS_00070870 other downstream 1133136 12521352 ~ 12669091 (-) True XLOC_036251
TCONS_00070869 other downstream 1133662 12465299 ~ 12668565 (-) False XLOC_036251
TCONS_00070909 other upstream 54630 13877728 ~ 13877845 (-) True XLOC_036279
TCONS_00070922 other upstream 269696 14092794 ~ 14094516 (-) True XLOC_036286
TCONS_00070936 other upstream 591255 14414353 ~ 14451783 (-) False XLOC_036294
TCONS_00070951 other upstream 1469269 15292367 ~ 15305523 (-) True XLOC_036304
TCONS_00070954 other upstream 1809634 15632732 ~ 15632847 (-) True XLOC_036307

Expression Profile

//