RNA id: TCONS_00071059


Basic Information

Item Value
RNA id TCONS_00071059
length 361
lncRNA type retained_intron
GC content 0.49
exon number 2
gene id XLOC_036353
representative False

Chromosome Information

Item Value
chromosome id NC_007119.7
NCBI id CM002892.2
chromosome length 54304671
location 18506141 ~ 18537882 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GGAAGAATTCAGACCAGGAAAACTTCGACTCAGTTTTGAAGAGCTGGAAAGACAGAGGCTGGAAGACGAACATAAGCGGGTTGAGGAAGAGAGGAAAAGACGCATTGAAGAAGAAAGAAAGGCCTTTGCTGAGGCCAGAAAGAGCATGGTTATAAATAGTGACGATGACATCCTGCTGGCCATGATCAACTCAGACGGGGCCAAACCCGGGAAGTTGGCCATTAGCTTTGAGGATTTGGAAAGACAGAGACAAGAAGAGGAGCAGAAACGCAAAGAGGAGGAGGCCAAGCGACGCCTGGAAGAGGAGAAAAGACTCTTCGCTGAAGCTCGAAAGAGCATGGTAGGACATGCACGAGATGTG

Function

GO:

id name namespace
GO:1990380 Lys48-specific deubiquitinase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-041114-92 Predicted to enable cell-cell adhesion mediator activity. Acts upstream of or within cardiac muscle cell development. Located in Z disc. Is expressed in adaxial cell; cardiovascular system; musculature system; and somite. Human ortholog(s) of this gene implicated in dilated cardiomyopathy 1CC and hypertrophic cardiomyopathy 20. Orthologous to human NEXN (nexilin F-actin binding protein).

Ensembl:

ensembl_id ENSDART00000148857

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00071043 lncRNA downstream 283611 18230965 ~ 18239449 (-) False XLOC_036348
TCONS_00071040 lncRNA downstream 294231 18225039 ~ 18228829 (-) True XLOC_036347
TCONS_00071041 lncRNA downstream 296992 18225039 ~ 18226068 (-) False XLOC_036347
TCONS_00071031 lncRNA downstream 319870 18200751 ~ 18203190 (-) False XLOC_036345
TCONS_00071023 lncRNA downstream 519376 18000382 ~ 18003684 (-) False XLOC_036342
TCONS_00072437 lncRNA upstream 69945 18594067 ~ 18599356 (-) True XLOC_036356
TCONS_00072023 lncRNA upstream 247485 18771607 ~ 18773009 (-) False XLOC_036359
TCONS_00072022 lncRNA upstream 247485 18771607 ~ 18773009 (-) True XLOC_036359
TCONS_00071073 lncRNA upstream 690085 19214207 ~ 19216638 (-) False XLOC_036363
TCONS_00072024 lncRNA upstream 949710 19473832 ~ 19477990 (-) True XLOC_036370
TCONS_00071053 mRNA downstream 6675 18506141 ~ 18516385 (-) False XLOC_036353
TCONS_00071051 mRNA downstream 62269 18450052 ~ 18460791 (-) False XLOC_036352
TCONS_00071052 mRNA downstream 62334 18456713 ~ 18460726 (-) True XLOC_036352
TCONS_00071050 mRNA downstream 124273 18369177 ~ 18398787 (-) True XLOC_036351
TCONS_00071049 mRNA downstream 155324 18356102 ~ 18367736 (-) True XLOC_036350
TCONS_00071062 mRNA upstream 2808 18526930 ~ 18537882 (-) False XLOC_036353
TCONS_00071063 mRNA upstream 8193 18532315 ~ 18537876 (-) True XLOC_036353
TCONS_00071064 mRNA upstream 41782 18565904 ~ 18582922 (-) True XLOC_036354
TCONS_00071066 mRNA upstream 77130 18601252 ~ 18613948 (-) True XLOC_036357
TCONS_00071067 mRNA upstream 126292 18650414 ~ 18667693 (-) True XLOC_036358
TCONS_00071054 other downstream 3939 18515040 ~ 18519121 (-) False XLOC_036353
TCONS_00071006 other downstream 1270706 17252239 ~ 17252354 (-) True XLOC_036332
TCONS_00070990 other downstream 1857414 16639131 ~ 16665646 (-) False XLOC_036324
TCONS_00070989 other downstream 1865974 16632735 ~ 16657086 (-) False XLOC_036324
TCONS_00070985 other downstream 1909951 16613029 ~ 16613109 (-) True XLOC_036322
TCONS_00071065 other upstream 60571 18584693 ~ 18584807 (-) True XLOC_036355
TCONS_00071074 other upstream 690603 19214725 ~ 19215684 (-) False XLOC_036363
TCONS_00071076 other upstream 690707 19214829 ~ 19216657 (-) True XLOC_036363
TCONS_00071084 other upstream 772040 19296162 ~ 19313415 (-) False XLOC_036367
TCONS_00071104 other upstream 1890724 20414846 ~ 20414961 (-) True XLOC_036381

Expression Profile

//