RNA id: TCONS_00073071



Basic Information


Item Value
RNA id TCONS_00073071
length 440
RNA type processed_transcript
GC content 0.50
exon number 2
gene id XLOC_037117
representative True

Chromosome Information


Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 23003208 ~ 23007941 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


GGTGTAAATGAGTTGTTCAGGGAAAACTCCTTGTTATGATGTGTTTGTGCAGAGCTCATGGCCGAGGCGCGTGTCATGGATCAGATGAGCAGCGGCGACAGCTCATCAGATTCCCACAGTTCCTCCTCATCCAGCAGCGGCGACAGCTCCAGCAGCAGTGACTCCGAGGATGAGGGTCGTCCTCCACAAAATCCACCCCCAGCTCCTCCTCAGAGCTCATCTGCCCTCAGCATATCTCAAAGCCGCGTGGAGGAGAGTGGCGGCGATTTCATGAACACACTCAAAAATGATCTCCAGTTGAGTGAGTCTGGAAGTGAAAGCGATGATGACTGACCGCAAACATACCTAATGCTGAAATAGGGTTTACAGGAAGCACAGTGTCCGTTCACTAGCTAAAAACTTCACATGATACCTGAATCCAGATCCCTAGTAACTTTTCA

Function


GO:

id name namespace
GO:0042074 cell migration involved in gastrulation biological_process
GO:0030111 regulation of Wnt signaling pathway biological_process
GO:0014812 muscle cell migration biological_process
GO:0007507 heart development biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0031016 pancreas development biological_process
GO:0060028 convergent extension involved in axis elongation biological_process
GO:0060029 convergent extension involved in organogenesis biological_process
GO:0032783 super elongation complex cellular_component
GO:0005515 protein binding molecular_function
GO:0070016 armadillo repeat domain binding molecular_function
GO:0008013 beta-catenin binding molecular_function

KEGG:

id description
ko03036 Chromosome and associated proteins

ZFIN:

id description
ZDB-GENE-040625-179 Enables armadillo repeat domain binding activity and beta-catenin binding activity. Acts upstream of or within several processes, including cell migration involved in gastrulation; convergent extension; and muscle cell migration. Predicted to be located in nucleus. Predicted to be part of transcription elongation factor complex. Is expressed in several structures, including blastoderm; blastodisc; nervous system; pleuroperitoneal region; and presumptive neural retina. Orthologous to human EAF2 (ELL associated factor 2).

Ensembl:

ensembl_id ENSDART00000134119

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00073069 lncRNA upstream 2001 23003876 ~ 23004450 (+) False XLOC_037117
TCONS_00075104 lncRNA upstream 8391 22988941 ~ 22998060 (+) True XLOC_037116
TCONS_00073062 lncRNA upstream 308597 22695633 ~ 22697854 (+) True XLOC_037112
TCONS_00074896 lncRNA upstream 363766 22642386 ~ 22642685 (+) True XLOC_037110
TCONS_00073038 lncRNA upstream 645709 22359962 ~ 22360742 (+) True XLOC_037106
TCONS_00074897 lncRNA downstream 119178 23126156 ~ 23128231 (+) False XLOC_037122
TCONS_00074898 lncRNA downstream 119565 23126543 ~ 23127995 (+) True XLOC_037122
TCONS_00074899 lncRNA downstream 314856 23321834 ~ 23333979 (+) True XLOC_037126
TCONS_00075106 lncRNA downstream 356870 23363848 ~ 23419530 (+) False XLOC_037127
TCONS_00075107 lncRNA downstream 356876 23363854 ~ 23456345 (+) False XLOC_037127
TCONS_00073067 mRNA upstream 66941 22929675 ~ 22939510 (+) True XLOC_037115
TCONS_00073065 mRNA upstream 204279 22781019 ~ 22802172 (+) False XLOC_037114
TCONS_00073066 mRNA upstream 204279 22782027 ~ 22802172 (+) True XLOC_037114
TCONS_00073064 mRNA upstream 204547 22780901 ~ 22801904 (+) False XLOC_037114
TCONS_00073063 mRNA upstream 226638 22764235 ~ 22779813 (+) True XLOC_037113
TCONS_00073072 mRNA downstream 2630 23009608 ~ 23023288 (+) True XLOC_037118
TCONS_00073074 mRNA downstream 42522 23049500 ~ 23056240 (+) True XLOC_037120
TCONS_00073075 mRNA downstream 117274 23124252 ~ 23162384 (+) True XLOC_037121
TCONS_00073076 mRNA downstream 217783 23224761 ~ 23231203 (+) True XLOC_037123
TCONS_00073077 mRNA downstream 225923 23232901 ~ 23234064 (+) True XLOC_037124
TCONS_00073057 other upstream 343723 22658229 ~ 22662728 (+) True XLOC_037111
TCONS_00073048 other upstream 429392 22576945 ~ 22577059 (+) True XLOC_037108
TCONS_00073045 other upstream 558873 22391566 ~ 22447578 (+) False XLOC_037107
TCONS_00073026 other upstream 1012536 21993128 ~ 21993915 (+) False XLOC_037097
TCONS_00073021 other upstream 1015239 21990058 ~ 21991212 (+) False XLOC_037096
TCONS_00073073 other downstream 39289 23046267 ~ 23046385 (+) True XLOC_037119
TCONS_00073080 other downstream 357264 23364242 ~ 23367209 (+) False XLOC_037128
TCONS_00073088 other downstream 540667 23547645 ~ 23555977 (+) True XLOC_037129
TCONS_00073090 other downstream 689946 23696924 ~ 23700456 (+) True XLOC_037131
TCONS_00073100 other downstream 878665 23885643 ~ 23886737 (+) True XLOC_037136

Expression Profile


//