RNA id: TCONS_00008672


Basic Information

Item Value
RNA id TCONS_00008672
length 278
lncRNA type sense_over
GC content 0.52
exon number 3
gene id XLOC_003655
representative False

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 39576541 ~ 39926872 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGGAAATCGCGGCCTACCTGATAACATTTGAGAAGCATGAAGAGTGGCTGACGACGTCCCCCAAAACCAGGCCGCAGAATGGCTCTATGATCCTCTACAACAGGAAGAAGGTGAAGTACAGAAAAGATGGCTACTGCTGGAAGAAGAGGAAAGATGGCAAAACCACACGGGAGGATCACATGAAGCTCAAAGTGCAGGGAGTCGAGTGTCTGTACGGCTGCTATGTCCACTCCTCCATCATCCCCACATTTCACCGCCGCTGCTACTGGCTGCTTCAG

Function

GO:

id name namespace
GO:0006887 exocytosis biological_process
GO:0099643 signal release from synapse biological_process
GO:0019228 neuronal action potential biological_process
GO:0043269 regulation of ion transport biological_process
GO:0050877 nervous system process biological_process
GO:0043010 camera-type eye development biological_process
GO:0007267 cell-cell signaling biological_process
GO:0007268 chemical synaptic transmission biological_process
GO:0007269 neurotransmitter secretion biological_process
GO:0001505 regulation of neurotransmitter levels biological_process
GO:0050953 sensory perception of light stimulus biological_process
GO:0099177 regulation of trans-synaptic signaling biological_process
GO:0098916 anterograde trans-synaptic signaling biological_process
GO:0002088 lens development in camera-type eye biological_process
GO:0007600 sensory perception biological_process
GO:0007601 visual perception biological_process
GO:0017156 calcium-ion regulated exocytosis biological_process
GO:0017157 regulation of exocytosis biological_process
GO:0048880 sensory system development biological_process
GO:0007626 locomotory behavior biological_process
GO:0099536 synaptic signaling biological_process
GO:0099537 trans-synaptic signaling biological_process
GO:0086010 membrane depolarization during action potential biological_process
GO:0051049 regulation of transport biological_process
GO:0003008 system process biological_process
GO:0051899 membrane depolarization biological_process
GO:0006812 cation transport biological_process
GO:0050803 regulation of synapse structure or activity biological_process
GO:0050804 modulation of chemical synaptic transmission biological_process
GO:0001654 eye development biological_process
GO:0006836 neurotransmitter transport biological_process
GO:0007423 sensory organ development biological_process
GO:0045055 regulated exocytosis biological_process
GO:0150063 visual system development biological_process
GO:1990351 transporter complex cellular_component
GO:0034702 ion channel complex cellular_component
GO:0034703 cation channel complex cellular_component
GO:0034706 sodium channel complex cellular_component
GO:0042995 cell projection cellular_component
GO:0043005 neuron projection cellular_component
GO:0030424 axon cellular_component
GO:0120025 plasma membrane bounded cell projection cellular_component
GO:0001518 voltage-gated sodium channel complex cellular_component
GO:0045202 synapse cellular_component
GO:0099503 secretory vesicle cellular_component
GO:0097458 obsolete neuron part cellular_component
GO:0070382 exocytic vesicle cellular_component
GO:1902495 transmembrane transporter complex cellular_component
GO:0005509 calcium ion binding molecular_function
GO:0000149 SNARE binding molecular_function
GO:0005198 structural molecule activity molecular_function
GO:0005212 structural constituent of eye lens molecular_function
GO:0005248 voltage-gated sodium channel activity molecular_function
GO:0005272 sodium channel activity molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00008418 lncRNA upstream 97274 39373712 ~ 39479267 (+) False XLOC_003654
TCONS_00008671 lncRNA upstream 199454 39373720 ~ 39377087 (+) True XLOC_003654
TCONS_00008417 lncRNA upstream 285907 39287369 ~ 39290634 (+) True XLOC_003653
TCONS_00008416 lncRNA upstream 292565 39262536 ~ 39283976 (+) True XLOC_003652
TCONS_00008669 lncRNA upstream 370396 39187538 ~ 39206145 (+) False XLOC_003651
TCONS_00008419 lncRNA downstream 94624 39909576 ~ 39922539 (+) True XLOC_003655
TCONS_00007112 lncRNA downstream 154352 39969304 ~ 39977128 (+) False XLOC_003657
TCONS_00007113 lncRNA downstream 179045 39993997 ~ 39998798 (+) True XLOC_003657
TCONS_00008673 lncRNA downstream 296529 40111481 ~ 40116646 (+) True XLOC_003659
TCONS_00008674 lncRNA downstream 405103 40220055 ~ 40434080 (+) True XLOC_003662
TCONS_00007101 mRNA upstream 428342 39120306 ~ 39148199 (+) False XLOC_003649
TCONS_00007103 mRNA upstream 428343 39135050 ~ 39148198 (+) False XLOC_003649
TCONS_00007102 mRNA upstream 434460 39120332 ~ 39142081 (+) False XLOC_003649
TCONS_00007104 mRNA upstream 435086 39135086 ~ 39141455 (+) True XLOC_003649
TCONS_00007099 mRNA upstream 464286 39105019 ~ 39112255 (+) False XLOC_003648
TCONS_00007107 mRNA downstream 113876 39928828 ~ 39954612 (+) False XLOC_003656
TCONS_00007108 mRNA downstream 113932 39928884 ~ 39953618 (+) False XLOC_003656
TCONS_00007109 mRNA downstream 120202 39935154 ~ 39956925 (+) True XLOC_003656
TCONS_00007110 mRNA downstream 144087 39959039 ~ 40021080 (+) False XLOC_003657
TCONS_00007111 mRNA downstream 154096 39969048 ~ 40014177 (+) False XLOC_003657
TCONS_00007097 other upstream 772803 38803611 ~ 38803738 (+) True XLOC_003642
TCONS_00007094 other upstream 987975 38588451 ~ 38588566 (+) True XLOC_003640
TCONS_00007079 other upstream 1925577 37638982 ~ 37650964 (+) False XLOC_003630
TCONS_00007127 other downstream 834519 40649471 ~ 40655871 (+) False XLOC_003667
TCONS_00007131 other downstream 1074228 40889180 ~ 40889294 (+) True XLOC_003670
TCONS_00007137 other downstream 1295717 41110669 ~ 41157928 (+) False XLOC_003675
TCONS_00007139 other downstream 1320657 41135609 ~ 41157926 (+) True XLOC_003675
TCONS_00007149 other downstream 1650155 41465107 ~ 41465236 (+) True XLOC_003680

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
bowfin (Amia calva) AMCG00004715 True 348 mRNA 0.54 5 PESF01000027.1 4518 ~ 6759 (+)