RNA id: TCONS_00073798



Basic Information


Item Value
RNA id TCONS_00073798
length 480
RNA type processed_transcript
GC content 0.45
exon number 3
gene id XLOC_037565
representative False

Chromosome Information


Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 1937049 ~ 1959917 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


GTAATTTTCTATGTTAAAGATCGAGCAGACAAACTCGAGGCTTTGGTAACCTGCATTACCAATTGCGTGTGTTGTCAGATGCTAGCTTGATGTGTGCTACAAGAGCTAAACAGAGCAAGCATTACAGTACTGGACGACAGACTTTGAAGCACGCTTCATAATATTCAGCACCATCGCCGGAGGCAAACCATGGATTACACGGCTTTGTTTGGTCGCCGTCAAAATTATGAGGATTGTTTGAGGAGAAAGAGAAGAGAGAAAACCACAGACTACGGTCAAAGGACAGAAAATCTGTGGGAAGCTCCAATCACGTGATTCACAAGTCCATGCTATTGGACAGGAGTTCACAGGATCTCTAAGTTTGAACCTTCGCAATGCAGAAAGCCACTTATTATGACAATGCTGGACTTTTCGGAGGATATTCGTACCCTAAATCTGACTCCTACACGTACGGTCCAACACACCAGGGCTTCTCATCCT

Function


GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0007275 multicellular organism development biological_process
GO:0009952 anterior/posterior pattern specification biological_process
GO:0045944 positive regulation of transcription by RNA polymerase II biological_process
GO:0048704 embryonic skeletal system morphogenesis biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-990415-120 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in anterior/posterior pattern specification; embryonic skeletal system morphogenesis; and regulation of transcription by RNA polymerase II. Predicted to act upstream of or within regulation of transcription, DNA-templated. Predicted to be active in nucleus. Is expressed in several structures, including hindbrain; hindbrain neural keel; neural tube; pectoral fin bud; and spinal cord. Orthologous to human HOXD3 (homeobox D3).

Ensembl:

ensembl_id ENSDART00000138730

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00075276 lncRNA downstream 2816 1931428 ~ 1936169 (-) False XLOC_037564
TCONS_00075275 lncRNA downstream 2816 1931428 ~ 1936169 (-) False XLOC_037564
TCONS_00075274 lncRNA downstream 3138 1931428 ~ 1935847 (-) False XLOC_037564
TCONS_00075273 lncRNA downstream 5113 1931428 ~ 1933872 (-) False XLOC_037564
TCONS_00075261 lncRNA downstream 158604 1463769 ~ 1780381 (-) False XLOC_037558
TCONS_00075277 lncRNA upstream 191370 2150922 ~ 2171296 (-) False XLOC_037572
TCONS_00075278 lncRNA upstream 191370 2150922 ~ 2173197 (-) True XLOC_037572
TCONS_00074958 lncRNA upstream 220967 2180519 ~ 2207258 (-) True XLOC_037573
TCONS_00075279 lncRNA upstream 276341 2235893 ~ 2277636 (-) True XLOC_037574
TCONS_00074959 lncRNA upstream 422789 2382341 ~ 2389808 (-) True XLOC_037576
TCONS_00073789 mRNA downstream 235184 1692926 ~ 1703801 (-) False XLOC_037562
TCONS_00073790 mRNA downstream 235184 1693369 ~ 1703801 (-) False XLOC_037562
TCONS_00073792 mRNA downstream 235224 1695321 ~ 1703761 (-) True XLOC_037562
TCONS_00073791 mRNA downstream 236337 1693535 ~ 1702648 (-) False XLOC_037562
TCONS_00073786 mRNA downstream 299020 1629307 ~ 1639965 (-) True XLOC_037560
TCONS_00073802 mRNA upstream 4453 1964005 ~ 1965727 (-) True XLOC_037567
TCONS_00073803 mRNA upstream 8155 1967707 ~ 1970071 (-) True XLOC_037568
TCONS_00073804 mRNA upstream 16266 1975818 ~ 1978090 (-) True XLOC_037569
TCONS_00073805 mRNA upstream 22330 1981882 ~ 1984604 (-) False XLOC_037570
TCONS_00073806 mRNA upstream 22330 1981882 ~ 1986014 (-) True XLOC_037570
TCONS_00073794 other downstream 4899 1931440 ~ 1934086 (-) True XLOC_037564
TCONS_00073793 other downstream 189949 1748919 ~ 1749036 (-) True XLOC_037563
TCONS_00073788 other downstream 294224 1644683 ~ 1644761 (-) True XLOC_037561
TCONS_00073777 other downstream 559495 1379376 ~ 1379490 (-) True XLOC_037555
TCONS_00073774 other downstream 935430 1003441 ~ 1003555 (-) True XLOC_037549
TCONS_00073808 other upstream 266911 2226463 ~ 2277492 (-) False XLOC_037574
TCONS_00073809 other upstream 371309 2330861 ~ 2337303 (-) True XLOC_037575
TCONS_00073827 other upstream 1531279 3490831 ~ 3496579 (-) True XLOC_037591
TCONS_00073830 other upstream 1548766 3508318 ~ 3519711 (-) True XLOC_037592
TCONS_00073841 other upstream 2484366 4443918 ~ 4447104 (-) True XLOC_037598

Expression Profile


//