RNA id: TCONS_00073967


Basic Information

Item Value
RNA id TCONS_00073967
length 101
RNA type miRNA
GC content 0.49
exon number 1
gene id XLOC_037669
representative True

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 11548233 ~ 11551704 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TCAACCACTGTCTTGTATCCGAGGCTTGTTTTAAGTTGCCTGCGATCTCTTAATGACTCAGGCAGCTAAAGCAAGTCTGGGAGGCCAGAGACAACACGACA

Function

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0030154 cell differentiation biological_process
GO:0007275 multicellular organism development biological_process
GO:0060218 hematopoietic stem cell differentiation biological_process
GO:0007399 nervous system development biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function

KEGG:

id description
ko05202 Transcriptional misregulation in cancer
ko03000 Transcription factors

Ensembl:

ensembl_id ENSDART00000118657

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00074962 lncRNA downstream 1180979 10368380 ~ 10370625 (-) True XLOC_037663
TCONS_00073926 lncRNA downstream 2180738 9355372 ~ 9370866 (-) True XLOC_037651
TCONS_00073922 lncRNA downstream 2262534 9286419 ~ 9289070 (-) True XLOC_037649
TCONS_00073923 lncRNA downstream 2262544 9286419 ~ 9289060 (-) False XLOC_037649
TCONS_00073924 lncRNA downstream 2262565 9286419 ~ 9289039 (-) False XLOC_037649
TCONS_00073971 lncRNA upstream 3372 11555076 ~ 11560109 (-) False XLOC_037670
TCONS_00073972 lncRNA upstream 5502 11557206 ~ 11560339 (-) True XLOC_037670
TCONS_00075298 lncRNA upstream 19608 11571312 ~ 11572249 (-) False XLOC_037671
TCONS_00075299 lncRNA upstream 19608 11571312 ~ 11572354 (-) False XLOC_037671
TCONS_00075300 lncRNA upstream 44283 11595987 ~ 11598944 (-) False XLOC_037673
TCONS_00073963 mRNA downstream 893 11548233 ~ 11550711 (-) False XLOC_037669
TCONS_00073966 mRNA downstream 2225 11548889 ~ 11549379 (-) False XLOC_037669
TCONS_00073962 mRNA downstream 288376 11245962 ~ 11263228 (-) True XLOC_037668
TCONS_00073959 mRNA downstream 746373 10781687 ~ 10805231 (-) False XLOC_037666
TCONS_00073958 mRNA downstream 746373 10781687 ~ 10805231 (-) False XLOC_037666
TCONS_00073968 mRNA upstream 2385 11554089 ~ 11560110 (-) False XLOC_037670
TCONS_00073969 mRNA upstream 2655 11554359 ~ 11560427 (-) False XLOC_037670
TCONS_00073970 mRNA upstream 2701 11554405 ~ 11560432 (-) False XLOC_037670
TCONS_00073974 mRNA upstream 24798 11576502 ~ 11587070 (-) True XLOC_037672
TCONS_00073975 mRNA upstream 45796 11597500 ~ 11655031 (-) False XLOC_037673
TCONS_00073965 other downstream 1207 11548772 ~ 11550397 (-) False XLOC_037669
TCONS_00073961 other downstream 705055 10845918 ~ 10846549 (-) True XLOC_037667
TCONS_00073935 other downstream 1746285 9743559 ~ 9805319 (-) False XLOC_037657
TCONS_00073936 other downstream 1746285 9770335 ~ 9805319 (-) True XLOC_037657
TCONS_00073901 other downstream 3896303 7641760 ~ 7655301 (-) True XLOC_037633
TCONS_00073973 other upstream 20269 11571973 ~ 11572055 (-) True XLOC_037671
TCONS_00073978 other upstream 270675 11822379 ~ 11855305 (-) True XLOC_037675
TCONS_00073998 other upstream 1030562 12582266 ~ 12594717 (-) False XLOC_037682
TCONS_00073999 other upstream 1032939 12584643 ~ 12594723 (-) False XLOC_037682
TCONS_00074000 other upstream 1033199 12584903 ~ 12594705 (-) False XLOC_037682

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
bowfin (Amia calva) TU101765 True 211 lncRNA 0.70 1 CM030129.1 35039257 ~ 35039467 (+)
tiger barb (Puntius tetrazona) TU101765 False 304 lncRNA 0.54 2 NC_056707.1 8867139 ~ 8868277 (+)