RNA id: TCONS_00000774



Basic Information


Item Value
RNA id TCONS_00000774
length 634
RNA type mRNA
GC content 0.54
exon number 5
gene id XLOC_000441
representative True

Chromosome Information


Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 38142354 ~ 38170906 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


CTCACCTTAAAGAGCGGCTGGAGGAGTACATAAAACAATGGAACGGGTTGGTCAAAGTGTTCCGCAATGAGAAGAGAGAGGGTCTGATCCAGGCCAGGAGCATAGGAGCCCGCAAAGCCACTTTAGGAAAGGTGCTGATCTACCTGGATGCACATTGTGAGGTCGGAGTGAACTGGTATGCCCCGCTGGTGGCCCCCATTTCAAAAGACAGAACGGTGTGCACAGTGCCTCTCATAGACTCTATTAACGGCAAGACTTACACCATCGAGGCCCAGGGGGGCGGGGACGAGGATGGCTTTGCCAGAGGAGCATGGGACTGGAGCATGCTTTGGAAACGCGTGCCTCTGGGTAGCAAGGAGAAGCAGAAGAGACTAACTAGAACTGAGCCCTATCGGTCTCCTGCCATGGCTGGAGGGCTGTTTGCAATTGAGAGAGAATTCTTCTTTGAGCTGGGTCTTTATGATCCAGGCCTTCAGATCTGGGGAGGTGAAAACTTTGAGATCTCATACAAGATATGGCAGTGCGGTGGGCAGCTTCTGTTCGTGCCATGTTCACGGGTGGGGCACATCTACCGTCTGCAGGGCTGGCAGGGAAACCCACCTCCTGCTCATGTCGGCTCATCCCCAACACTTAA

Function


GO:

id name namespace
GO:0006486 protein glycosylation biological_process
GO:0005794 Golgi apparatus cellular_component
GO:0000139 Golgi membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0016740 transferase activity molecular_function
GO:0016757 transferase activity, transferring glycosyl groups molecular_function
GO:0030246 carbohydrate binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050522-284 Predicted to enable carbohydrate binding activity and hexosyltransferase activity. Predicted to be involved in protein glycosylation. Predicted to be located in Golgi membrane. Predicted to be integral component of membrane. Predicted to be active in Golgi apparatus. Orthologous to human GALNT7 (polypeptide N-acetylgalactosaminyltransferase 7).

Ensembl:

ensembl_id ENSDART00000135666

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00003090 lncRNA upstream 319552 37833347 ~ 37834392 (+) True XLOC_000439
TCONS_00002857 lncRNA upstream 515577 37591258 ~ 37638367 (+) True XLOC_000436
TCONS_00000764 lncRNA upstream 736313 37404990 ~ 37417631 (+) True XLOC_000435
TCONS_00000758 lncRNA upstream 861763 37284575 ~ 37292181 (+) True XLOC_000433
TCONS_00000757 lncRNA upstream 894232 37212236 ~ 37259712 (+) False XLOC_000433
TCONS_00003091 lncRNA downstream 9281 38171857 ~ 38278251 (+) False XLOC_000442
TCONS_00003092 lncRNA downstream 21223 38183799 ~ 38187194 (+) True XLOC_000443
TCONS_00003093 lncRNA downstream 100124 38262700 ~ 38278251 (+) False XLOC_000442
TCONS_00000775 lncRNA downstream 101117 38263693 ~ 38278434 (+) False XLOC_000442
TCONS_00000776 lncRNA downstream 101117 38263693 ~ 38324035 (+) True XLOC_000442
TCONS_00000767 mRNA upstream 21332 37752171 ~ 38132612 (+) False XLOC_000438
TCONS_00000768 mRNA upstream 22129 37752291 ~ 38131815 (+) True XLOC_000438
TCONS_00000766 mRNA upstream 143042 37752171 ~ 38010902 (+) False XLOC_000438
TCONS_00000765 mRNA upstream 449761 37701261 ~ 37704183 (+) True XLOC_000437
TCONS_00000763 mRNA upstream 734071 37391716 ~ 37419873 (+) False XLOC_000435
TCONS_00000778 mRNA downstream 199836 38362412 ~ 38374799 (+) True XLOC_000445
TCONS_00000780 mRNA downstream 595685 38758261 ~ 38802422 (+) False XLOC_000447
TCONS_00000781 mRNA downstream 595869 38758445 ~ 38802648 (+) False XLOC_000447
TCONS_00000782 mRNA downstream 612465 38775041 ~ 38802422 (+) False XLOC_000447
TCONS_00000783 mRNA downstream 613718 38776294 ~ 38803495 (+) True XLOC_000447
TCONS_00000769 other upstream 157367 37996459 ~ 37996577 (+) True XLOC_000440
TCONS_00000744 other upstream 1030172 37123642 ~ 37123772 (+) True XLOC_000432
TCONS_00000740 other upstream 1407375 36728297 ~ 36746569 (+) True XLOC_000429
TCONS_00000735 other upstream 1463045 36665543 ~ 36690899 (+) False XLOC_000428
TCONS_00000728 other upstream 1999567 36154261 ~ 36154377 (+) True XLOC_000425
TCONS_00000777 other downstream 199772 38362348 ~ 38374799 (+) False XLOC_000445
TCONS_00000779 other downstream 503178 38665754 ~ 38753029 (+) True XLOC_000446
TCONS_00000785 other downstream 655736 38818312 ~ 38822163 (+) False XLOC_000448
TCONS_00000786 other downstream 657001 38819577 ~ 38822163 (+) True XLOC_000448
TCONS_00000794 other downstream 1351165 39513741 ~ 39513857 (+) True XLOC_000454

Expression Profile


//