RNA id: TCONS_00072828



Basic Information


Item Value
RNA id TCONS_00072828
length 645
RNA type mRNA
GC content 0.48
exon number 5
gene id XLOC_036999
representative True

Chromosome Information


Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 12894578 ~ 12903567 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


CCAGAGGGTTTCCATTAAGAGAGGGAGACATACTGAGTCCAGGATCCCGCAGTGCCATTACCTGTCTAGGAGATTCCTGCCGCTGGCCCAAAGCTGTGGACGGATTTGTGTATGTACCATACATCATGTCCACATTATATGATGATATGGACAGAATCACGATAGAAACAGGGATGTTGGACATTTCCTCGTCAACCTGTGTAAAGTTTGTCCCTCGCACACATCAAGCAAACTTCCTCAATATTCAGCCTAGATATGGCTGCTGGTCATATCTGGGAATGACAGGAGGCAGTCAGACGGTCTCTCTGCAGTCTCCAGGCTGCATGTGGTCAGGAGTGGCGTCCCATGAGCTCATGCACGCTCTTGGTTTTGTACACGAACAGTCCCGCTCTGACCGTGACCGCTACGTTTCCATCCTATGGGAAAACATCATAGAGAATCAAAGACACAACTTTAGAAAGTATGAGACCAACAACCTCAATACCGCATATGACTACAGTTCTGTCATGCACTACGGGAGGTATGCCTTCTCAGAGGATGGGGGGCCCACCATCATTCCTAAACCAGACCCTTACATTCCCATTGGCCAGAGAGACGGACCAAGTATTCTGGACATTCACAAAATAAACATCTTGTATAACTGTG

Function


GO:

id name namespace
GO:0006508 proteolysis biological_process
GO:0046872 metal ion binding molecular_function
GO:0004222 metalloendopeptidase activity molecular_function
GO:0016787 hydrolase activity molecular_function
GO:0008233 peptidase activity molecular_function
GO:0008237 metallopeptidase activity molecular_function
GO:0008270 zinc ion binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070912-147 Predicted to enable metalloendopeptidase activity. Predicted to act upstream of or within proteolysis.

Ensembl:

ensembl_id ENSDART00000136417

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00075073 lncRNA upstream 427297 12461619 ~ 12469043 (+) True XLOC_036995
TCONS_00072807 lncRNA upstream 1957871 10936773 ~ 10938469 (+) True XLOC_036987
TCONS_00075072 lncRNA upstream 2136227 10737086 ~ 10760113 (+) True XLOC_036985
TCONS_00074886 lncRNA upstream 2331394 10562638 ~ 10564946 (+) True XLOC_036982
TCONS_00075071 lncRNA upstream 2738793 10155978 ~ 10157547 (+) True XLOC_036979
TCONS_00072832 lncRNA downstream 42316 12943279 ~ 12943755 (+) False XLOC_037000
TCONS_00072835 lncRNA downstream 175889 13076852 ~ 13089863 (+) True XLOC_037001
TCONS_00072841 lncRNA downstream 332612 13233575 ~ 13234144 (+) False XLOC_037003
TCONS_00072842 lncRNA downstream 334057 13235020 ~ 13239029 (+) False XLOC_037003
TCONS_00075074 lncRNA downstream 568111 13469074 ~ 13471527 (+) True XLOC_037005
TCONS_00072825 mRNA upstream 2249 12887491 ~ 12894091 (+) False XLOC_036998
TCONS_00072826 mRNA upstream 2532 12890161 ~ 12893808 (+) True XLOC_036998
TCONS_00072823 mRNA upstream 27291 12847040 ~ 12869049 (+) False XLOC_036997
TCONS_00072824 mRNA upstream 30340 12847110 ~ 12866000 (+) True XLOC_036997
TCONS_00072819 mRNA upstream 440819 12444494 ~ 12455521 (+) False XLOC_036994
TCONS_00072829 mRNA downstream 4628 12905591 ~ 12915657 (+) False XLOC_037000
TCONS_00072830 mRNA downstream 6611 12907574 ~ 12953824 (+) False XLOC_037000
TCONS_00072831 mRNA downstream 33573 12934536 ~ 12944019 (+) False XLOC_037000
TCONS_00072833 mRNA downstream 47548 12948511 ~ 12951339 (+) True XLOC_037000
TCONS_00072834 mRNA downstream 58797 12959760 ~ 13111163 (+) False XLOC_037001
TCONS_00072822 other upstream 68220 12828005 ~ 12828120 (+) True XLOC_036996
TCONS_00072821 other upstream 441397 12444524 ~ 12454943 (+) True XLOC_036994
TCONS_00072820 other upstream 441582 12444519 ~ 12454758 (+) False XLOC_036994
TCONS_00072815 other upstream 1448431 11447777 ~ 11447909 (+) True XLOC_036991
TCONS_00072801 other upstream 2552360 10343864 ~ 10343980 (+) True XLOC_036980
TCONS_00072843 other downstream 337854 13238817 ~ 13246526 (+) True XLOC_037003
TCONS_00072844 other downstream 547566 13448529 ~ 13448648 (+) True XLOC_037004
TCONS_00072854 other downstream 813448 13714411 ~ 13728936 (+) True XLOC_037008
TCONS_00072861 other downstream 864294 13765257 ~ 13786953 (+) True XLOC_037009
TCONS_00072865 other downstream 1098840 13999803 ~ 14003253 (+) True XLOC_037011

Expression Profile


//