RNA id: TCONS_00074886


Basic Information

Item Value
RNA id TCONS_00074886
length 854
lncRNA type intronic
GC content 0.36
exon number 3
gene id XLOC_036982
representative True

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 10562638 ~ 10564946 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

atttattagagcagctgtcgatgtgggcaggtgttcataaaacgtgattttaatagtttggcgtgactcctttttcattgcccgggatttagcaggcagacgcagcttctgcaatggtcgacattaactgctcccagcagcggatctgattaacacgataccaaagtgattttgttacctgtggatcttcaaacttcacatccagagttgtgaggaatcagaggtgcatgcggctgcccacgggaaaaatttgccatcagcccaacacagtttggattatcataggactgtcagaggtttgccaaacctgtcaaatgcatgatggctcctgtttggacttaccgatgtcctcgacttcaagtatccatcaaaactgtatacatttgagatatattagagactctttgtgggactggacattatgcatcctaaatctttatcaaaatatgcaaatctcctcactgagttgccttggatgatttctcaataggatctggtattattaatgtttttatttatgtattgtgtatgtgtagccacattaatggcctattttgtagtcactattaaaaggaacatcgattgatattgaatacatgttatggtctttaatccatcttcccattcttatttaattgttattgacaggaaagtctgtttatctgtttttactagtgtatattgtgcttacaatatagaaacgaagatttattttctgaggttacagccagaagtcaattaaattagttttaaatgacatatgcatggttaattttatttagatcattaagttcataatacttaattaaaatgagtacagtcaacatatagcaatgtataagtaagttaagttt

Function

GO:

id name namespace
GO:0001704 formation of primary germ layer biological_process
GO:0001706 endoderm formation biological_process
GO:0042074 cell migration involved in gastrulation biological_process
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0007492 endoderm development biological_process
GO:0048762 mesenchymal cell differentiation biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0065007 biological regulation biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0002030 inhibitory G protein-coupled receptor phosphorylation biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0009888 tissue development biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0060976 coronary vasculature development biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0048598 embryonic morphogenesis biological_process
GO:0010467 gene expression biological_process
GO:0044237 cellular metabolic process biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044238 primary metabolic process biological_process
GO:1904323 regulation of inhibitory G protein-coupled receptor phosphorylation biological_process
GO:1904325 positive regulation of inhibitory G protein-coupled receptor phosphorylation biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0001570 vasculogenesis biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0051281 positive regulation of release of sequestered calcium ion into cytosol biological_process
GO:0060485 mesenchyme development biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0007369 gastrulation biological_process
GO:0071704 organic substance metabolic process biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0010524 positive regulation of calcium ion transport into cytosol biological_process
GO:0050789 regulation of biological process biological_process
GO:0050794 regulation of cellular process biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:1903587 regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:1903589 positive regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0001667 ameboidal-type cell migration biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:0035987 endodermal cell differentiation biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0008078 mesodermal cell migration biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0005634 nucleus cellular_component
GO:0043227 membrane-bounded organelle cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0060182 apelin receptor activity molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00075071 lncRNA upstream 405091 10155978 ~ 10157547 (+) True XLOC_036979
TCONS_00072798 lncRNA upstream 627572 9934310 ~ 9935066 (+) True XLOC_036977
TCONS_00075070 lncRNA upstream 665681 9893106 ~ 9896957 (+) True XLOC_036976
TCONS_00075069 lncRNA upstream 1597508 8930004 ~ 8965130 (+) False XLOC_036967
TCONS_00075072 lncRNA downstream 172140 10737086 ~ 10760113 (+) True XLOC_036985
TCONS_00072807 lncRNA downstream 371827 10936773 ~ 10938469 (+) True XLOC_036987
TCONS_00075073 lncRNA downstream 1896673 12461619 ~ 12469043 (+) True XLOC_036995
TCONS_00072832 lncRNA downstream 2378333 12943279 ~ 12943755 (+) False XLOC_037000
TCONS_00072835 lncRNA downstream 2511906 13076852 ~ 13089863 (+) True XLOC_037001
TCONS_00072799 mRNA upstream 518779 10014514 ~ 10043859 (+) False XLOC_036978
TCONS_00072800 mRNA upstream 518779 10014817 ~ 10043859 (+) True XLOC_036978
TCONS_00072796 mRNA upstream 612151 9927516 ~ 9950487 (+) False XLOC_036977
TCONS_00072797 mRNA upstream 615184 9927624 ~ 9947454 (+) False XLOC_036977
TCONS_00072795 mRNA upstream 696107 9858935 ~ 9866531 (+) True XLOC_036975
TCONS_00072803 mRNA downstream 127959 10692905 ~ 10694930 (+) True XLOC_036983
TCONS_00072804 mRNA downstream 134092 10699038 ~ 10759513 (+) True XLOC_036984
TCONS_00072806 mRNA downstream 205934 10770880 ~ 10780660 (+) False XLOC_036986
TCONS_00072805 mRNA downstream 205934 10770880 ~ 10780660 (+) True XLOC_036986
TCONS_00072808 mRNA downstream 469368 11034314 ~ 11229565 (+) False XLOC_036988
TCONS_00072801 other upstream 218658 10343864 ~ 10343980 (+) True XLOC_036980
TCONS_00072788 other upstream 1170407 9371502 ~ 9392231 (+) True XLOC_036971
TCONS_00072789 other upstream 1184660 9377863 ~ 9377978 (+) True XLOC_036972
TCONS_00072785 other upstream 1443391 9118553 ~ 9119247 (+) True XLOC_036969
TCONS_00072784 other upstream 1444338 9116996 ~ 9118300 (+) False XLOC_036969
TCONS_00072815 other downstream 882831 11447777 ~ 11447909 (+) True XLOC_036991
TCONS_00072820 other downstream 1879573 12444519 ~ 12454758 (+) False XLOC_036994
TCONS_00072821 other downstream 1879578 12444524 ~ 12454943 (+) True XLOC_036994
TCONS_00072822 other downstream 2263059 12828005 ~ 12828120 (+) True XLOC_036996
TCONS_00072843 other downstream 2673871 13238817 ~ 13246526 (+) True XLOC_037003

Expression Profile

//