CI01000057_02618561_02619733 (GATA2A, GATA2)


Basic Information

Item Value
gene id CI01000057_02618561_02619733
gene name GATA2A, GATA2
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 2618420 ~ 2619771 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000057_02618561_02619733.mRNA
GTATAAAGGAGCTAACGCAAGGCCCCTGTCAAGGGGATGCGATGGAGTGTGGGTCTTCAGTGAGGTTCGGCCCAGGCGGGTGAGCGGCTGGAATGATGAGGGTGGCTGAATGTTGGGTGAATGGGAGTCGGCGTGGGCAGCATGTGTCCAGAATGGCTAAACGGTGGCAGGTGGCCCATGTGTGGCATGTGGCTTGCCAGAGCACTGGCGCTGCCAAATGGAGAGGTCTTGTCCTGCATGCACTTGGAGAGCTCCTCGAAACCCTCGCCAGATCGTTTATTCCTCTTGGACTTGCTGGACATCTTGCGGTTGCGTGTTTGGATGCCCTCTTTCTTCATGGTCAGTGGCCTATTGACCTATAAGAAACGAGATAGGGGAAAGCCGGCTTTGCGTCCCCGGTCTCACTCTCACCCTCTCTTCAATCGATACAAGCTGTCCGCCCACTTGAGCACTTTGCTGTCACTTTCAGTGTTTGCGACTCTTAATACTCACGTTGTGGAGTTTGTAGTAGAGCCCGCAGGCGTTGCACACCGGGTCACCGTTCCCGTTGCGCCGCCACAGAGTGGTCGTGGTTGTCTGGCAGTTCGCGCAGCAGGTGCCGGCTCGCCTCGCAGCAGACTGTAGGCAAGAAAAAAACAGAATATTCAATACTGAGTACTAAA

Function

symbol description
gata2a Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Acts upstream of or within animal organ development and dorsal aorta morphogenesis. Predicted to be located in nucleus. Is expressed in several structures, including hematopoietic system; mesoderm; nervous system; neural tube; and trunk vasculature. Human ortholog(s) of this gene implicated in acute myeloid leukemia; immunodeficiency 21; mental depression; myelodysplastic syndrome; and myeloid leukemia. Orthologous to human GATA2 (GATA binding protein 2).
gata2 Enables several functions, including C2H2 zinc finger domain binding activity; DNA-binding transcription factor activity, RNA polymerase II-specific; and chromatin binding activity. Involved in several processes, including negative regulation of endothelial cell apoptotic process; positive regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis; and regulation of gene expression. Acts upstream of or within negative regulation of Notch signaling pathway; negative regulation of neural precursor cell proliferation; and positive regulation of angiogenesis. Located in cytoplasm and nucleoplasm. Implicated in acute myeloid leukemia; immunodeficiency 21; mental depression; myelodysplastic syndrome; and myeloid leukemia. Biomarker of acute myeloid leukemia; aplastic anemia; clear cell renal cell carcinoma; immunodeficiency 21; and myelodysplastic syndrome.

GO:

id name namespace
GO:0001085 RNA polymerase II transcription factor binding molecular_function

KEGG:

id description
K17894 GATA2; GATA-binding protein 2

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000057_02618561_02619733.mRNA True 662 mRNA 0.55 2 2618420 2619771

Neighbor

gene id symbol gene type direction distance location
CI01000057_02548444_02558549 NA coding upstream 58728 2547895 ~ 2559692 (+)
CI01000057_02416295_02420310 CDA coding upstream 197878 2416295 ~ 2420542 (+)
CI01000057_02412538_02415631 NA coding upstream 202487 2411516 ~ 2415933 (+)
CI01000057_02395285_02396439 NA coding upstream 221859 2394598 ~ 2396561 (+)
CI01000057_02347155_02370642 PUSL1 coding upstream 247756 2347155 ~ 2370664 (+)
CI01000057_02693930_02700711 GNL3 coding downstream 74159 2693930 ~ 2700711 (+)
CI01000057_02707814_02708251 NA coding downstream 88043 2707814 ~ 2708374 (+)
CI01000057_02758170_02782493 CAMK1A, CAMK1.L, CAMK1B, CAMK1 coding downstream 138399 2758170 ~ 2782566 (+)
CI01000057_02794112_02799150 NA coding downstream 174220 2793991 ~ 2799153 (+)
CI01000057_02884788_02888727 NA coding downstream 264310 2884081 ~ 2888805 (+)
G243986 NA non-coding upstream 26049 2592133 ~ 2592371 (+)
G243985 NA non-coding upstream 26651 2591498 ~ 2591769 (+)
G243973 NA non-coding upstream 47622 2570555 ~ 2570798 (+)
G243933 NA non-coding upstream 116511 2501533 ~ 2501909 (+)
G243874 NA non-coding upstream 163303 2438184 ~ 2455117 (+)
G243995 NA non-coding downstream 2740 2622511 ~ 2625912 (+)
G243991 NA non-coding downstream 15466 2635237 ~ 2652560 (+)
G243992 NA non-coding downstream 31259 2651030 ~ 2660593 (+)
G244003 NA non-coding downstream 43257 2663028 ~ 2666310 (+)
G243999 NA non-coding downstream 85146 2704917 ~ 2705443 (+)
G243975 NA other upstream 41568 2576453 ~ 2576852 (+)
G243558 NA other upstream 1660049 956063 ~ 958371 (+)
G243557 NA other upstream 1663225 954843 ~ 955195 (+)
CI01000057_00417827_00418207 NA other upstream 2197910 417700 ~ 418655 (+)
G245231 NA other downstream 467325 3087096 ~ 3292562 (+)
G245401 NA other downstream 917798 3537569 ~ 3538442 (+)
CI01000057_03842028_03844033 NDUFS7.S, MGC85267, NDUFS7 other downstream 1222257 3842028 ~ 3844691 (+)
G245486 NA other downstream 1590126 4209897 ~ 4212081 (+)

Expression


Co-expression Network