CI01000057_04088057_04092278 (CTNS)


Basic Information

Item Value
gene id CI01000057_04088057_04092278
gene name CTNS
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 4088057 ~ 4092278 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000057_04088057_04092278.mRNA
ATGCAGAAGTGACCATCAAAGCGCCAGCAACAGTGAATCTACAGGAAACATCCTCAGAAAACATCACCTTTACACTAAGTTCATCGTTGAATACATCTGTAACAGTTTATTTCAATATCACATTTACATCAAAAAATGTCTCTTCAATAATTCAACTGCCTGATGAGGTTGTTGTGCCAGCAGGAAACACATCTGTATCTTTTGAAGTGCTGGCAAAAGGGGTTGGTCAGCTGACCGCTTACCTTTACAGCAATGACACTCGCATAAAAAGAAGCAATGTCCTTTTCATCATCAACCAAATCATTGGCTGGATTTACTTCCTGGCCTGGTCCGTGTCGTTCTACCCACAAGCGTATGAGAACTGGAAACGACGCAGTGTGGTGGGCCTCAATTTTGATTTCCTCGCTCTCAACCTGACTGGATTCATTGCTTACAGTGTGTTCAATGTTGGCCTGTTCTGGGTGACTTATATACAGGAGGAGTTCTTGAAGAAAGATCCGAATGGTGTCATTCCTGTCGATGCCAATGATGTCTTCTTCAGTCTCCATGCAGTAGTTCTCACTCTCGTCTATATTTGCCAGTGTGCCATCTATGAG

Function

symbol description
ctns Predicted to enable L-cystine transmembrane transporter activity. Acts upstream of or within glomerular filtration; regulation of autophagy; and renal absorption. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in lysosomal membrane. Used to study cystinosis. Human ortholog(s) of this gene implicated in cystinosis. Orthologous to human CTNS (cystinosin, lysosomal cystine transporter).

GO:

id name namespace
GO:0005765 lysosomal membrane cellular_component

KEGG:

id description
K12386 CTNS; cystinosin

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000057_04088057_04092278.mRNA True 596 mRNA 0.43 6 4088057 4092278

Neighbor

gene id symbol gene type direction distance location
CI01000057_04029208_04038844 SLC1A6 coding upstream 49147 4029208 ~ 4038910 (+)
CI01000057_04008460_04012934 TAX1BP3.S, TAX1BP3, MGC83163 coding upstream 75082 4008190 ~ 4012975 (+)
CI01000057_03999611_04005699 NR2F6, NR2F6A, NR2F6B coding upstream 80955 3999611 ~ 4007102 (+)
CI01000057_03973241_03985010 USHBP1 coding upstream 103000 3973241 ~ 3985057 (+)
CI01000057_03943917_03961522 GTPBP3 coding upstream 126520 3943917 ~ 3961537 (+)
CI01000057_04105710_04123101 RANBP3A, RANBP3 coding downstream 13432 4105710 ~ 4123718 (+)
CI01000057_04202045_04205390 VMAC coding downstream 109494 4201772 ~ 4205479 (+)
CI01000057_04218508_04219283 GA45B, GADD45B, GADD45BA coding downstream 126056 4218334 ~ 4219894 (+)
CI01000057_04357565_04358136 NA coding downstream 265287 4357565 ~ 4359044 (+)
CI01000057_04364304_04364681 NA coding downstream 271676 4359098 ~ 4365796 (+)
G245519 NA non-coding upstream 27469 4060202 ~ 4060588 (+)
G245513 NA non-coding upstream 46568 4041187 ~ 4041489 (+)
G245493 NA non-coding upstream 117988 3969790 ~ 3970069 (+)
G245444 NA non-coding upstream 161752 3919805 ~ 3926305 (+)
G245441 NA non-coding upstream 169460 3911591 ~ 3918597 (+)
G245526 NA non-coding downstream 48873 4141151 ~ 4142227 (+)
G245539 NA non-coding downstream 63519 4155797 ~ 4161350 (+)
G245550 NA non-coding downstream 107960 4200238 ~ 4200458 (+)
G245473 NA non-coding downstream 115661 4207939 ~ 4208938 (+)
G245562 NA non-coding downstream 139171 4231449 ~ 4231683 (+)
CI01000057_03842028_03844033 NDUFS7.S, MGC85267, NDUFS7 other upstream 243366 3842028 ~ 3844691 (+)
G245401 NA other upstream 549615 3537569 ~ 3538442 (+)
G245231 NA other upstream 795495 3087096 ~ 3292562 (+)
G243991 NA other upstream 1435497 2635237 ~ 2652560 (+)
G243975 NA other upstream 1511205 2576453 ~ 2576852 (+)
G245486 NA other downstream 117619 4209897 ~ 4212081 (+)
G245725 NA other downstream 1006407 5098685 ~ 5103606 (+)
CI01000057_05564489_05579041 NA other downstream 1481626 5564489 ~ 5579843 (+)
G245856 NA other downstream 1545376 5637654 ~ 5643340 (+)
G245857 NA other downstream 1562998 5655276 ~ 5657239 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_003196 ctns coding NC_007122.7 CM002895.2 6281647 ~ 6293709 (+)