G245695


Basic Information

Item Value
gene id G245695
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 4916751 ~ 4918708 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU278898
CCTCTTGTTTCCCACCAAAGAATGATGTCACGTCCTTCCAGCCTTTAGCACCAGCACCCTGAACCTTAGTGGCCAGACCTGTGATGCCGACGGCCATTTCATCAAACAACTTCCCCTCCTTCACCTAGACGAGTCACAGCAGAAACGCACTTGTGTGAATGCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU278898 True 163 lncRNA 0.52 2 4916751 4918708

Neighbor

gene id symbol gene type direction distance location
CI01000057_04842021_04842320 NA coding upstream 74419 4841301 ~ 4842332 (+)
CI01000057_04781699_04785615 NA coding upstream 131100 4781699 ~ 4785651 (+)
CI01000057_04773601_04773990 NA coding upstream 142761 4773396 ~ 4773990 (+)
CI01000057_04755505_04764341 NA coding upstream 152339 4755505 ~ 4764412 (+)
CI01000057_04737652_04740503 METTL21B coding upstream 175770 4737652 ~ 4740981 (+)
CI01000057_04949557_05007535 IARS coding downstream 30849 4949557 ~ 5008172 (+)
CI01000057_05089046_05116009 NA coding downstream 169551 5088259 ~ 5116074 (+)
CI01000057_05119106_05161147 ATP2B2 coding downstream 200286 5118994 ~ 5162116 (+)
CI01000057_05190329_05218573 SLC6A11 coding downstream 271451 5190159 ~ 5218846 (+)
CI01000057_05263212_05269456 SLC6A1B, SLC6A1, SLC6A1A coding downstream 343163 5261871 ~ 5269510 (+)
G245692 NA non-coding upstream 106 4912736 ~ 4916645 (+)
G245703 NA non-coding upstream 5872 4903293 ~ 4910879 (+)
G245681 NA non-coding upstream 122034 4792989 ~ 4794717 (+)
G245678 NA non-coding upstream 135750 4780418 ~ 4781001 (+)
G245671 NA non-coding upstream 166692 4749807 ~ 4750059 (+)
G245705 NA non-coding downstream 7104 4925812 ~ 4927527 (+)
G245706 NA non-coding downstream 12121 4930829 ~ 4931175 (+)
G245715 NA non-coding downstream 17049 4935757 ~ 4936143 (+)
G245711 NA non-coding downstream 17957 4936665 ~ 4937158 (+)
G245804 NA non-coding downstream 379145 5297853 ~ 5298085 (+)
G245486 NA other upstream 704670 4209897 ~ 4212081 (+)
CI01000057_03842028_03844033 NDUFS7.S, MGC85267, NDUFS7 other upstream 1072060 3842028 ~ 3844691 (+)
G245401 NA other upstream 1378309 3537569 ~ 3538442 (+)
G245231 NA other upstream 1624189 3087096 ~ 3292562 (+)
G243991 NA other upstream 2264191 2635237 ~ 2652560 (+)
G245725 NA other downstream 179977 5098685 ~ 5103606 (+)
CI01000057_05564489_05579041 NA other downstream 655196 5564489 ~ 5579843 (+)
G245856 NA other downstream 718946 5637654 ~ 5643340 (+)
G245857 NA other downstream 736568 5655276 ~ 5657239 (+)
CI01000057_05912175_05916639 NA other downstream 993105 5911767 ~ 5917211 (+)

Expression


Co-expression Network