G678945


Basic Information

Item Value
gene id G678945
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 1706515 ~ 1707619 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU799627
TGTTTCTCGCATCACTAGTTTAAACTGTCTTCTTCTACATTACACTAACAGACACACCAGGCTAAAGCTTTACCGGGAGGTGCAGTACTGTCTTGGCTTCATTCTTCTTTATGTTGTGACCTTCCAGAGGAATATACTCAATCTTCCCGCTCTGGGTGAAGAGGATGTGACTGCCAGGAGGCAAAGGACTAATGCTAGGGTTGGGTGTTGGTCTAATCGGGCTGGGCACATCATGAGTCAGGAAATTGTCCGGGTCCCAAGCGGGTGCCAGAGATCTCCACTCCATTGCGGTCCACGCACCAGCACTGCCGAATGCTGGCGTGACACTGCATGGGTTCGTACTCGCCATTGGCATCACAGGTCGGCACATACTGACCAGGCGCAGGACGAGGACCACGGGGGTCAGACCTGGAGCCCACAATGCTCTCCCTGTGCAGCTCGCAGCGTGTCTTCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU799627 True 454 lncRNA 0.54 2 1706515 1707619

Neighbor

gene id symbol gene type direction distance location
CI01180000_01576739_01578505 GNG4 coding upstream 127109 1576739 ~ 1579406 (+)
CI01180000_01542059_01545609 GGPS1 coding upstream 160435 1542059 ~ 1546080 (+)
CI01180000_01492241_01493781 NA coding upstream 212069 1491671 ~ 1494446 (+)
CI01180000_01380859_01385445 NA coding upstream 320732 1380701 ~ 1385783 (+)
CI01180000_01372608_01374455 NA coding upstream 331968 1370761 ~ 1374547 (+)
CI01180000_01747067_01755038 GPR137B coding downstream 39448 1747067 ~ 1755257 (+)
CI01180000_01828938_01830221 DNAJC12 coding downstream 121319 1828938 ~ 1830814 (+)
CI01180000_01832263_01834405 COX5B.2, COX5B2, COX5B coding downstream 124394 1832013 ~ 1834999 (+)
CI01180000_01865632_01870994 NA coding downstream 157890 1865509 ~ 1871089 (+)
CI01180000_01915282_01926129 NA coding downstream 207273 1914892 ~ 1926269 (+)
G678946 NA non-coding upstream 93968 1518353 ~ 1612547 (+)
G678948 NA non-coding upstream 113468 1591172 ~ 1593047 (+)
G678869 NA non-coding upstream 273652 1431965 ~ 1432863 (+)
G678929 NA non-coding upstream 274774 1431505 ~ 1431741 (+)
G678868 NA non-coding upstream 275548 1429873 ~ 1430967 (+)
G678942 NA non-coding downstream 19542 1727161 ~ 1733717 (+)
G679064 NA non-coding downstream 27798 1735417 ~ 1735761 (+)
G679069 NA non-coding downstream 57691 1765310 ~ 1765538 (+)
G679052 NA non-coding downstream 69091 1776710 ~ 1777125 (+)
G679072 NA non-coding downstream 70971 1778590 ~ 1779698 (+)
G678637 NA other upstream 550843 1149551 ~ 1155672 (+)
G678751 NA other upstream 640424 1059843 ~ 1066091 (+)
G678440 NA other upstream 1554863 147934 ~ 151652 (+)
G679076 NA other downstream 87551 1795170 ~ 1799433 (+)
G679324 NA other downstream 681248 2388867 ~ 2397360 (+)
CI01180000_02690045_02691641 NKX6-2, NKX6-2.L, NKX6.2 other downstream 982143 2689271 ~ 2693221 (+)
CI01180000_03571292_03571611 GNG2.L, GBG2, GNG2 other downstream 1845658 3569165 ~ 3573135 (+)
G680736 NA other downstream 2058072 3765691 ~ 3784441 (+)

Expression


Co-expression Network